Table 1

PCR primers for amplification of chIFN-α, chIL-18, AIH9, IFN-γ, IL-4, and GAPDH
Target gene Primer sequence (5′-3′) Accession no. Reference
chIFN-αa F ATGGCTGTGCCTGCAAGCCCA DQ026259.1 -
R CTAAGTGCGCGTGTTGCCTGT
chIL-18b Fc
    GAATTC
GCCTTTTGTAAGGATAAAACT
HM854281.1 -
Rc
    AAGCTT
TCAGTGATGGTGATGGTGATG TAGGTTGTGCCTTTC
AIH9 F CTACTGTTGGGAGGAAGAGAATGGT AF461510.1 [29]
R TGGGCGTCTTGAATAGGGTAA
IFN-γ F CAAAGCCGCACATCAAACA X99774 [30]
R TTTCACCTTCTTCACGCCATC
IL-4 F GAGAGGTTTCCTGCGTCAAG FJ907790.1 [31]
R TGGTGGAAGAAGGTACGTAGG
GAPDH F AGAACATCATCCCAGCGTCC X01578 [30]
R CGGCAGGTCAGGTCAACA

aThe primer pair specific for chIFN-α gene was designed using chIFN-α6 nucleotide sequences (Genbank accession number DQ026259.1), and the sequences of the two primers were checked using NCBI Blast Software.

bThe primer pair specific for chIL-18 gene was designed using chIL-18 nucleotide sequences (Genbank accession number HM854281.1), and the sequences of the two primers were checked using NCBI Blast Software.

cThe forward and reverse primers specific for chIL-18 gene contain EcoRI and HindIII restriction sites as indicated by the underline. The reverse primer also contained 6×His-Tag sequences indicated in boldface.

Rahman et al.

Rahman et al. BMC Veterinary Research 2012 8:105   doi:10.1186/1746-6148-8-105

Open Data