Table 1

Primers and probes used in this study

Target

Size of amplified sequence (bp)

Primers and probes

GenBank accession no.


IS1245

82

Primer 41: ggtgagcggatcactcaag*

Primer 116: ggagaagccccgatgaac

Probe 3: caagccttgatcgacgcgga

L33879


IS6110

101

Primer 149: gccaactacggtgtttacgg

Primer 150: agtttggtcatcagccgttc

Probe 6: gggcatcgaggtggccagat

X17348.1


Porcine β-globin

gene

119

Primer 120: gggggttgcaatttattcct

Primer 121: tgaatcacggtcctgtgaaa

Probe 4: cgcagattcccaaaccttcgc

X86791


*[18]

Agdestein et al. BMC Veterinary Research 2011 7:63   doi:10.1186/1746-6148-7-63

Open Data