Table 1 |
|||
|
Primers and probes used in this study |
|||
|
Target |
Size of amplified sequence (bp) |
Primers and probes |
GenBank accession no. |
|
|
|||
|
IS1245 |
82 |
Primer 41: ggtgagcggatcactcaag* Primer 116: ggagaagccccgatgaac Probe 3: caagccttgatcgacgcgga |
|
|
|
|||
|
IS6110 |
101 |
Primer 149: gccaactacggtgtttacgg Primer 150: agtttggtcatcagccgttc Probe 6: gggcatcgaggtggccagat |
|
|
|
|||
|
Porcine β-globin gene |
119 |
Primer 120: gggggttgcaatttattcct Primer 121: tgaatcacggtcctgtgaaa Probe 4: cgcagattcccaaaccttcgc |
|
|
|
|||
|
*[18] |
|||
|
Agdestein et al. BMC Veterinary Research 2011 7:63 doi:10.1186/1746-6148-7-63 |
|||
