Table 1

Primers used for mapping and tissue-specific expression of pig AKR1C genes.

Marker

GenBank Accession1

TIGR Contig

Forward primer (5'→3')

Reverse primer (5'→3')

Application

Size (bp)


AKR1CL2

DQ494488

TC204964

gcgtctattacctccttgcatc

acctcgttctcattgtggtaca

RH mapping

441

AKR1C1

BV677932

TC223177

ggagtgttttctctccatggtc

cctatttcaatgatccacacga

RH mapping

322

AKR1C2

BV680531

None

atcccaaagccagtgtctg

ttacatctgatctgccaaggtg

RH mapping

348

AKR1C3

DQ494490

TC200330

taagggcagacacagcttgata

tggaatacaaaactgaggcaga

RH mapping

279

AKR1C4

BV680541

TC200328

atcatcacctagggtcaacaattc

gagctcccgctcagtactcttcag

RH mapping

345

SB89 microsatellite

DQ487182

None

ttccacaccctctccttctcta

tgaaattcagttggaaagttttga

RH/linkage map

150

SB90 microsatellite

DQ487183

None

gggaattccatatgccatgagt

aagctgcagaaagagggaagta

RH/linkage map

117

SB91 microsatellite

DQ487184

None

aaattgaggaggagggaacagt

gtcaacaagatatggcctgta

RH/linkage map

165

AKR1CL2

DQ474064

TC204964

acccataccttacgcagaagaa

aaattctcaagaatccgctttg

RT-PCR

240

AKR1C1

DQ474065

TC223177

cgatggtcacttcattcctgta

agtgcttttccgttttcatctg

RT-PCR

380

AKR1C2

DQ474066

None

tccttcgaccagagttggtcca

catttgacttgcagaaatccag

RT-PCR

364

AKR1C3

DQ474067

TC200330

ccattcagatgaaaattgcaga

ctcgttcttgcacttctccat

RT-PCR

280

AKR1C4

DQ474068

TC200328

aagacagagtgagcccagccg

cacctcctcctcgttttcatag

RT-PCR

215


1Accession number is for genomic DNA for RH/linkage markers and mRNA sequence for RT-PCR.

Nonneman et al. BMC Veterinary Research 2006 2:28   doi:10.1186/1746-6148-2-28

Open Data