Table 1

Primers used for real-time PCR

Target group

Oligonucleotide sequence (5′-3′)

Reference

Amplicon size (bp)


Bacteroidetes

CATGTGGTTTAATTCGATGAT

Guo et al. 2008 [30]

126

AGCTGACGACAACCATGCAG

Bacteroides

GAGAGGAAGGTCCCCCAC

Guo et al. 2008 [30]

106

CGCTACTTGGCTGGTTCAG

Lactobacillus

GAGGCAGCAGTAGGGAATCTTC

Delroisse et al. 2008 [31]

126

GGCCAGTTACTACCTCTATCCTTCTTC

Fusobacterium

CCCTTCAGTGCCGCAGT

Friswell et al. 2010 [32]

273

GTCGCAGGATGTCAAGAC

Firmicutes

ATGTGGTTTAATTCGAAGCA

Guo et al. 2008 [30]

126

AGCTGACGACAACCATGCAC

Actinobacteria

CGCGGCCTATCAGCTTGTTG

Stach et al. 2003 [33]

600

CCGTACTCCCCAGGCGGGG

Bifidobacterium

CTCCTGGAAACGGGTGG

Matsuki et al. 2004 [34]

550

GGTGTTCTTCCCGATATCTACA

Prevotella

GGTTCTGAGAGGAAGGTCCCC

Bekele et al. 2010 [35]

121

TCCTGCACGCTACTTGGCTG

Enterococcus

CCCTTATTGTTAGTTGCCATCATT

Rinttilä et al. 2004 [36]

144

ACTCGTTCTTCCCATGT

Proteobacteria

CATGACGTTACCCGCAGAAGAAG

Friswell et al. 2010 [32]

195

CTCTACGAGACTCAAGCTTGC

Clostridium Cluster IV

GCACAAGCAGTGGAGT

Matsuki et al. 2004 [34]

239

CTTCCTCCGTTTTGTCAA

Blautia coccoides-Eubacterium rectale group

CGGTACCTGACTAAGAAGC

Rinttilä et al. 2004 [36]

429

AGTTTCATTCTTGCGAACG

Veillonella

ACCAACCTGCCCTTCAGA

Rinttilä et al. 2004 [36]

343

CGTCCCGATTAACAGAGCTT

β-globin

GAAGAGCCAAGGACAGGTAC

Fredricks et al. 2007 [37]

270

CAACTTCATCCACGTTCACC


Murri et al. BMC Medicine 2013 11:46   doi:10.1186/1741-7015-11-46

Open Data