Table 2

Primer series of Bax, Bcl-2, β-actin and caspase-3

Genes

upstream (5'-3')

downstream (5'-3')

Bp


Bax

GCGATGAACTGGACAACAACAT

TAGCAAAGTAGAAAAGGGCAACC

153

Bcl-2

ATGTGTGTGGAGAGCGTCAACC

CCAGGAGAAATCAAACAGAGGC

174

β-actin

ATGGTGGGTATGGGTCAGAA

ACCCTCATAGATGGGCACAG

375

caspase-3

TGGTTCATCCAGTCGCTTTGT

CAAATTCTGTTGCCACCTTTCG

103


Wang et al. BMC Medicine 2013 11:32   doi:10.1186/1741-7015-11-32

Open Data