Table 1

Oligonucleotide sequences of primers used in real-time RT-PCR.

Gene

Sequence (5' → 3')


E-cadherin

F

TGAAGGTGACAGAGCCTCTGGA

R

TGGGTGAATTCGGGCTTGTT

Vimentin

F

TGGCCGACGCCATCAACACC

R

CACCTCGACGCGGGCTTTGT

N-cadherin

F

GCGCGTGAAGGTTTGCCAGTG

R

CCGGCGTTTCATCCATACCACAA

β-catenin

F

AGCCGACACCAAGAAGCAGAGATG

R

CGGCGCTGGGTATCCTGATGT

Snail

F

CCTCCCTGTCAGATGAGGAC

R

CCAGGCTGAGGTATTCCTTG

GAPDH

F

TGCCAAATATGATGACATCAAGAA

R

GGAGTGGGTGTCGCTGTTG


Zhang et al. BMC Medicine 2012 10:85   doi:10.1186/1741-7015-10-85

Open Data