Table 1

Summary of polymerase chain reaction (PCR) conditions

Gene

GeneBank accession no. [NM_]

Forward primer 5'-3'

Reverse primer 5'-3'

Tm (°C)

Product length (bp)


Alk1

NM_000020.1

GCTCAGACACGACAACATCC

ATTGCGGCTCTTGAAGTCG

60

256

Alk2

NM_001616.2

CTTGCATTGCTGACTTTGG

CCAATTTCCTCCTCAAATGG

60

253

Alk3

NM_004329

CACTGCCCCCTGTTGTCATAG

ATCCTGTTCCAAATCACGATTGT

58

179

Alk5

NM_004612.1

TGTTGGTACCCAAGGAAAGC

AACATCGTCGAGCAATTTCC

60

287

Alk6

NM_001203

CTTTTGCGAAGTGCAGGAAAAT

TGTTGACTGAGTCTTCTGGACAA

56

130

TGFβRII

NM_3242.3

ATGCTGCTTCTCCAAAGTGC

AGGTTGAACTCACGTTCTGC

57

258

Smad1

NM_005900.1

CAACGGAGTAACTGTGTCACC

ATTCGCTGTGTCTTGGAACC

60

259

Smad2

NM_00100365

CAAACCAGGTCTCTTGATGG

GAGGCGGAAGTTCTGTTAGG

60

259

Smad3

NM_005902.2

GGAGAAATGGTGCGAGAAGG

GAAGGCGAACTCACACAGC

60

258

Smad4

NM_005359.3

TGAATCCATATCACTACGAAC

CAGGCTGACTTGTGGAAG

60

294

Smad5

NM_005903.5

AACCTGAGCCACAAGAAC

GGCTGGGAATTATCTTGACC

60

245

Smad6

NM_U59914

GGCAAACCCATAGAGACACAA

GGTAGCCTCCGTTTCAGTGTA

56

123

Smad7

NM_005904.1

TTCGGACAACAAGAGTCAGC

AAGCCTTGATGGAGAAACC

60

201

Smurf1

NM_020429.1

CAGCATCAAGATCCGTCTGA

GCATAGATCCAAACGCTGGT

58

325

Smurf2

NM_022739.3

AGACTGGTGTGAGCACATGG

CACTTGCTGTTGCTGTTGGT

58

239

SARA

NM_007324.2

TGGTTTGCTGATGGGATCTT

TTCCAACAGGACTTCCAACC

58

196

BAMBI

NM_012342.2

GGATCGCCACTCCAGCTAC

TGGTGTCCGTGAAAGCTGTA

58

603

Ski

NM_003036.3

TCCGCGTGTACCACGAGTGC

AGCAGGATGTAGGCCCGCCA

60

208

SnoN

NM_005414.3

GCCACGAACTTTTCCTCAAA

GCTGGGGTGTAAAAATGAATG

58

493

Noggin

NM_005450.4

CAGCGACAACCTGCCCCTGG

GATCTCGCTCGGCATGGCCC

56

249

Sclerostin

NM_025237.2

CAGCTGCCGCGAGCTGCACT

GCACTTGCACGAGGCCACCA

62

248

β-Actin

NM_001101.3

CGACAACGGCTCCGGCATGT

GCACAGTGTGGGTGACCCCG

64

461


Alk = activin receptor-like kinase; BAMBI = bone morphogenic protein and activin receptor membrane bound inhibitor; SARA = Smad anchor for receptor activation; Ski = v-ski sarcoma viral oncogene homolog; Smurf = Smad ubiquitination regulatory factors; SnoN = Ski-related novel protein N; TGFβRII = transforming growth factor β receptor II.

Ehnert et al. BMC Medicine 2012 10:101   doi:10.1186/1741-7015-10-101

Open Data