Table 3

Primers used for reverse transcription polymerase chain reaction analysis and sequence confirmation.

Use

Primer

Oligonucleotide sequence


RT-PCR

all1101-F

CGCTGCTCTATCGCCTGACTG


all1101-R

GCGTACTTTCCAGCGATTGTGC


all2148-F

ACGGTGACGGGGGAAACAGGA


all2148-R

ACTTCCACTCGCTCAATCGTCC


all2158-F

CACCACCAGCAGAACCAACAGC


all2158-R

CGATAAATCCACCTCACCACGG


all2236-F

AATCGCGCGGCACTCTACCGT


all2236-R

GGATAACTCCAATCCCACGAGC


all2610-F

CAGTCATAGGAGAGGCGGGATT


all2610-R

CATAGAGTACAGAAGCCGGTCC


all2620-F

AAACTCCCTCAACCGCGCTGG


all2620-R

GGAATCCGCGAACCATCGGC


all2674-F

CCCAGAAACACCTACCGCAGAA


all2674-R

AACTAGGTTGACGACCCCACCT


all3310-F

TTTAGGCAACCCAGGCGGCAC


all3310-R

GCATTATGCTCAAAGGTGACGCG


all4026-F

GTGGTTTTTGTGGAGTGTGGGG


all4026-R

CCATCAACTGGTGTGTCTTCCC


all4924-F

CCCTACCAGAGGATCTGGGGA


all4924-R

CTGTACCAACGGCTGGTAAGAC


alr0397-F

TGCGTCGCGGGATTTGCGAAC


alr0397-R

GGATAGTATTGACCCTGGGGTC


alr2153-F

CCTCCCGTGGGATTAACTTTGG


alr2153-R

CGCATCAGGGCCCACTCGA


alr2175-F

GGTGTCCCGGCTGTTGGTACT


alr2175-R

AGTACCTCAAACCTCTCTGGGC


alr2185-F

CCCCGTCAGGTACTCGAAGAC


alr2185-R

TCTTCCATGTCAAGCTAGGGGC


alr2209-F

CCTACTCCCACACCCCCAAC


alr2209-R

CTGTCTTGGTCAGGTCTTCGGG


alr2211-F

CAAGATCGCCAAGTGGTGAGGC


alr2211-R

GTGTTTCCAGGTAACAAGCCCC


alr2581-F

GCGGGGACAGAAGGCAAATTTG


alr2581-R

CGCCTAATTGTTCTGTACCCCC


alr2588-F

CAGGTGAGGCGGGATTACCTG


alr2588-R

ACTCCCCCTGGTTCTAGTTGTC


alr2592-F

CCCCAAAGCCAGTGGAGGGA


alr2592-R

CCCCTAGCGGCTCGAACATTG


alr2596-F

CGCCTGTGCGCGATATTCCTG


alr2596-R

CAGGCGCAACAAATACCCGTTC


alr2626-F

GGCGTTCAACCAGGGGGAGT


alr2626-R

CTAAACCAGGTCTGGGTATGGC


alr3242-F

CCCGACGTGATAGTGGGTCAC


alr3242-R

CTGGGGGAATCCGGCTGCAT


rnpB-F

AGGGAGAGAGTAGG GTTGG


rnpB-R

GGTTTACCGAGCCAGTACCTCT


Sequence confirmation

all2619-20 F

CTCCCATTTCTCCGAAGCTG


all2619-20 R

CAACGCTGGGGCCAACATAG


alr4028-29 F

CTATGGACTTAACCAACAAAGCATTC


alr4028-29 R

CTTCTCTGGTTTAAGGTCAGGATTAC


Mirus et al. BMC Biology 2009 7:68   doi:10.1186/1741-7007-7-68

Open Data