Table 2 |
||||||
|
Comparison of the nuclear genomes of Cyanidioschyzon, Ostreococcus (an ultra-small green alga), Arabidopsis (a flowering plant) and Ashbya (a filamentous fungal pathogen). |
||||||
|
Organism |
No. of protein-coding genes |
Genes with introns (%) |
No. of rRNA gene units |
No. of chromosomes with histone genes |
Transposable elements in genome (%) |
Telomere repeat sequences |
|
|
||||||
|
Arabidopsis |
26207 |
79 |
~800 |
5≤ |
~15 |
TTTAGGG |
|
Ostreococcus |
8166 |
39 |
4 |
6≤ |
~10 |
TTTAGGG |
|
Cyanidioschyzon |
4775 |
0.5 |
3 |
1 |
0.7 |
AATGGGGGG |
|
Ashbya |
4718 |
5 |
~50 |
4≤ |
0.1> |
CGCTGAGAGACCCATACACCACAC |
|
|
||||||
|
Bold type indicates the smallest number in non-symbiotic eukaryotes. Two non-symbiotic eukaryotes, Schizosaccharomyces pombe and the filamentous fungus Ashbya gossypii, have nuclear protein-coding genes that are as small in number as those of C. merolae. The number of protein-coding genes in the nuclear genome of S. pombe [6] increased to 5004 http://www.sanger.ac.uk/Projects/S_pombe/genome_stats.shtml webcite. Although A. gossypii was reported to contain 4718 protein-coding nuclear genes [13], the genome project of this fungus is now in progress http://agd.unibas.ch/ webcite; thus it possibly contains more than 4775 protein-coding genes. |
||||||
|
Nozaki et al. BMC Biology 2007 5:28 doi:10.1186/1741-7007-5-28 |
||||||