Table 1

Primer sequences used for reverse transcription-PCR in this study
Gene Direction Primer sequence 5′→3′ Annealing temperature, °C Amplicon size, bp
FoxM1B Forward GGGCGCACGGCGGAAGATGAA 55 492
Reverse CCACTCTTCCAAGGGAGGGCTC
Fibrinogen β Forward CAAGGTGTCAACGACAATGAGGAG 55 315
Reverse CAGGTCTGGGTCAGCGTGAAGAGA
HNF4α Forward CTGCTCGGAGCCACCAAGAGATCCATG 55 370
Reverse ATCATCTGCCACGTGATGCTCTGCA
AFP Forward AGAACCTGTCACAAGCTGTG 55 675
Reverse GACAGCAAGCTGAGGATGTC
ApoA-II Forward GGAGAAGGTCAAGAGCCCGAG 55 246
Reverse AGCAAAGAGTGGGTAGGGACAG
FIX Forward GTCCTGTGAACCAGCAGTGCC 56 512
Reverse TTGTCAGCAATGCAAATAGGT
Β-actin Forward TCACCACCACGGCCGAGCG 58 350
Reverse TCTCCTTCTGCATCCTGTCG

Yang et al.

Yang et al. BMC Biology 2013 11:86   doi:10.1186/1741-7007-11-86

Open Data