Table 4

Primers used for detection of Notch alleles.

Primer

Sequence (5'→3')


Notch2 forward

GCTCAGCTAGAGTGTTGTTCTTG

Notch 2 forward

ATAACGCTAAACGTGCACTGGAG


Flox forward

TAGGAAGCAGCTCAGCTCACAG


Xu and Gridley BMC Biology 2013 11:13   doi:10.1186/1741-7007-11-13

Open Data