Figure 3.

Target genes, effector and binding sites of IpsA. (A) Binding of IpsA to 30 bp oligonucleotides covering the binding sites in the putative target promoters. As negative control the oligonucleotide cg3323-d (sequence AGGTCTGATTTCTGCTGGGAATCCCCACAT) was used, which is located immediately downstream of the IpsA binding sites in the cg3323 promoter. (B) The influence of intermediates in inositol metabolism (5 mM each) on the binding of IpsA to the ino1 promoter. myo-I, myo-inositol; I1P, 1D-myo-inositol-1-phosphate; I3P, 1D-myo-inositol-3-phosphate; G6P, glucose-6-phosphate. (C) The IpsA consensus motif predicted by MEME [20] and an overview of the sites in the corresponding promoter regions. (D) Promoter-fusion studies using the promoter of ino1 fused to eyfp (pJC1-Pcg3323-eyfp). The specific fluorescence of ATCC 13032 containing this plasmid on glucose was set to 1 and the other values were calculated accordingly.

Baumgart et al. BMC Biology 2013 11:122   doi:10.1186/1741-7007-11-122
Download authors' original image