Table 1

Primers used in experiments

Purpose

Sequence (5' → 3')


Screening ES cells

Left arm F

CCGCCTACATTCTCCATCTTCTCCA


Left arm R

CAGTCCCTTCCCGCTTCAGTGACAA


Right arm F

TACGTATGGCACATAGAACTTGATA


Right arm R

GAGCACCCAGTCCGCCCTGAGCAAA


RT-PCR

Forward

CGGGACAAAGGGAAGCGAAG


Reverse

CGCCACATGCCACCAATAATC


Nested PCR for amplicons produced by RT-PCR

Forward

GGACAAAGGGAAGCGAAGCCGGAGCTG


Reverse

GCCACATGCCACCAATAATCTTGCCAAT


Production of probe for Southern blot

Forward

CCACTCCCCGTGGAACACGC


Reverse

CCGTGACCCGGCTGTTGGTG


Abbreviations: ES, embryonic stem; RT, reverse transcriptase.

Chaiyachati et al. BMC Biology 2012 10:96   doi:10.1186/1741-7007-10-96

Open Data