Table 1

Primers used for amplification and sequencing of the RBL2 gene.

Exon

Primer sequence (5'-3')

Annealing temperature

Product size (bp)


19-1

Forward

AGGGTGTGCTCAACAAATAC

50

142

Reverse

CTGTTGGAGAATTCTGATGG

19-2

Forward

TCTCTAAAGGTGTATAGAAGTG

50

161

Reverse

GAAAAGCTCCTAATTTTGTC

20-1

Forward

ATTAGCAGCCTTTGTACTGAC

55

148

Reverse

ACTGTTGGCACCTGTGAGG

20-2

Forward

AGCAGTGCTCCTCCCACA

50

174

Reverse

AAAGTATGAAATAATCCCTG

21

Forward

CTCTCTCCCTATCCATTTG

50

143

Reverse

GGACTGTTGCTGAAGTAATAG

22-1

Forward

CTGAGCTATGTGCATTTGCA

52

148

Reverse

TTTGCAGGTGATTCACTTCC

22-2

Forward

AAAGAGAGGAATTCTTTTGG

54

145

Reverse

AGAGTTTAATACAAGAGACT


Kalungi et al. BMC Clinical Pathology 2009 9:6   doi:10.1186/1472-6890-9-6

Open Data