Table 1

Sequences of primers used in real-time PCR
Gene Forward Reverse Accession no. Length (bp)
iNOS AAGGTCTACGTTCAGGACATC AGAAATAGTCTTCCACCTGCT NM_010927 187
COX-2 TTCCTCTACATAAGCCAGTGA TCCACATTACATGCTCCTATC NM_011198 200
GAPDH TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGA NM_008084 77

Chun et al.

Chun et al. BMC Complementary and Alternative Medicine 2014 14:234   doi:10.1186/1472-6882-14-234

Open Data