Table 1

Primer sequences used in this study
Target gene Forward primer (5'-3') Reverse primer (5'-3')
TGFβ1 GTGGCTGAACCAAGGAGACG CAGGTGTTGAGCCCTTTCCAG
CTGF GCCCTAGCTGCCTACCGACT ACAGGCTTGGCAATTTTAGGC
Smad2 TCGGAAAGGGCTGCCACAT AGTCATCCAGAGGCGGCAG
Smad3 AGGGCTTTGAGGCTGTCTACC ACCCGATCCCTTTACTCCCA
Smad7 GGGGGAACGAATTATCTGGC CGCCATCCACTTCCCTTGT
GAPDH AGTGCCAGCCTCGTCTCATAG CGTTGAACTTGCCGTGGGTAG

Yao et al.

Yao et al. BMC Complementary and Alternative Medicine 2012 12:156   doi:10.1186/1472-6882-12-156

Open Data