Table 1

Details of primer sequences used in qPCR analysis

Gene of interest

Genbank Accession Numbers

Sequences of primers

Amplicon length (bp)


Cyclophilin

NM_021130.3

FP: 5' CATCTGCACTGCCAAGACTGA 3'

72

RP: 5' TTCATGCCTTCTTTCACTTTGC 3'

SNAT2

NM_018976.4

FP: 5' TGCTGTGCCAATTCTGATCTTT 3'

185

RP: 5' TGAGACTATGACGCCACCAACT 3'

LAT1

NM_003486.5

FP: 5' AGGAGCCTTCCTTTCTCCTG 3'

181

RP: 5' CTGCAAACCCTAAGGCAGAG 3'

LAT4

NM_152346.1

FP: 5' TCTCTCCGTGCTCATCTTCA 3'

165

RP: 5' ATTCCTGGAAAGGTGACTGC 3'

CD98hc

NM_002394.5

FP: 5' GCAGATCGACCCCAATTTTG 3'

79


Gran and Cameron-Smith BMC Physiology 2011 11:10   doi:10.1186/1472-6793-11-10

Open Data