Table 1

Primers used in each reaction combination

Forward

Reverse


18S

Amp 1

SSU01_F

SSU82_R_short

AACCTGGTTGATCCTGCCAGT

TGATCCTTCTGCAGGTTCACC

Amp 2

Fragment 1

SSU01_F

SSU26_R

AACCTGGTTGATCCTGCCAGT

CATTCTTGGCAAATGCTTTCG

Fragment 2

SSU22_F

SSU13_R

TCCAAGGAAGGCAGCAGGC

GGGCATCACAGACCTGTTA

Fragment 3

SSU26_F

SSU82_R

CGAAAGCATTTGCCAAGAATG

TGATCCTTCTGCAGGTTCACCTAC


CO1

Amp 1

LCO_1490

mtD9_2206

GGTCAACAAATCATAAAGATATTGG

CCCGGTAAAATTAAAATATAAACTTC

Amp 2

LCO_1490

HCO_2198

GGTCAACAAATCATAAAGATATTGG

TAAACTTCAGGGTGACCAAAAAATCA


Wingless

Amp 1

Wg1s_F

Wg2n_R

GARTGYAARTGYCAYGG

ACYTCRCARCACCARTG

Amp 2

Wg1a_F

Wgs_R

GARTGYAARTGYCAYGGYATGTCTGG

ACYTCRCARCACCARTGRAA


Alpha Spectrin

Amp 1

Aspec11_F

Aspec15_R

TGGATHMGNGARAARGA

AARTCRTCRAAYTTYTTYTG

Amp 2

Aspec11_F

Aspec12_R

TGGATHMGNGARAARGA

ACYTCNACYTTCCACCARTC


Elongation Factor 1alpha

Amp 1

237_F

1450_R

CGGYCAYTTGATCTACAAATGC

TGTCRCGCACAGCGAAACKACC

Amp 2

277_F

1221L_R

ACSATYGAGAAGTTCGAGAAG

GGRTGRTTMARIACRATMACCTG


Each sequence corresponds to one of two oligo-nucleotide primers used for each specific reaction. In addition, all forward primers were tailed with M13_REV (CAGGAAACAGCTATGACC) and all reverse primers were tailed with M13 – 21 (TGTAAAACGACGGCCAGT). Primers for 18S were adapted from [55]. LCO/HCO primers for CO1 were designed by [56]. mtD9 was designed by [57]. Wingless and Alpha Spectrin primers were sourced from [58]. Elongation Factor 1 alpha primers were designed from GenBank alignments of onychophora, tardigrade, drosophila and artemia.

Sands et al. BMC Ecology 2008 8:7   doi:10.1186/1472-6785-8-7

Open Data