Table 1

Primers and PCR protocols
PCR recipe for rbc L and ITS2 (total volume of the reaction: 12.5 μL)
Reagents Final concentration Volume per reaction (μL)
10%trehalose 5% 6.25
ddH20 2.00
10X buffer 1x 1.25
50 mM MgCl2 2.5 mM 0.625
10 μM primer F 0.1 0.125
10 μM primer R 0.1 0.125
10 mM dNTPs 0.05 0.0625
Polymerase (5 U/μl) 0.024 U/μL 0.06
TOTAL 10.50
DNA template (20-40 ng/μL) 2 .00
PCR recipe for matK (total volume of the reaction: 7.5 μL)
Reagents Final concentration Volume per reaction(μL)
20% trehalose 5% 1.875
ddH20 2.60
10X buffer 1x 0.75
50 mM MgCl2 1.5 mM 0.225
10 μM primer F 0.5 0.375
10 μM primer R 0.5 0.375
10 mM dNTPs 0.2 0.15
Polymerase (5 U/μl) 0.1 U/μL 0.15
TOTAL 6.50
DNA template (2-4 ng/μL) 1.00
Primer sets
Sequence Reference
rbcL primers
rbcLa-F ATGTCACCACAAACAGAGACTAAAGC [49] Levin et al. 2003
rbcLa-R GTAAAATCAAGTCCACCRCG [16] Kress & Erickson, 2009
matK primers
MatK-1RKIM-f ACCCAGTCCATCTGGAAATCTTGGTTC Ki-Joong Kim, pers. comm.
MatK-3FKIM-r CGTACAGTACTTTTGTGTTTACGAG Ki-Joong Kim, pers. comm.
MatK_390f CGATCTATTCATTCAATATTTC [51] Cuenoud et al. 2002
MatK_1326r TCTAGCACACGAAAGTCGAAGT [51] Cuenoud et al. 2002
ITS2 primers
ITS2-S2F ATGCGATACTTGGTGTGAAT [17] Chen et al. 2010
ITS4 TCCTCCGCTTATTGATATGC [50] White et al. 1990

Kuzmina et al.

Kuzmina et al. BMC Ecology 2012 12:25   doi:10.1186/1472-6785-12-25

Open Data