Table 1

Oligonucleotides used in this study as primers for PCR
Primer 5-3sequence Use
cspD2F CGGGGTACCGGCACTGCACAGCCGATGCT Amplification of cspD2 promoter
cspD2R GGAATTCCATATGCAATCAACCGTTGGGCCG
HlaR CGGGATCCCTACGTCTGAGCGATTCT Amplification of bga gene
HlaF GGGAATTCCATATGCGTCTCGGAGTCTG
β-gal 05R TCGAAGGAGCCGTACTGCTG Sequencing of bga gene
β-gal 15 F CCGTCGATCAGCACGAGTCG
β-gal 04 F GATTGTGCCGACGCGTTCCG
β-gal 16R TCCAGCCACTCCGCCCAGGT
β-gal 11R TCCTCGGACGTGTGTGCGGC
β-gal l10F GCACCACGCCGCCGCCCACG
pKJprmhtrF TTATTCCGTTTCCGCGGAAA Sequencing of cspD2 promoter in pMC2 plasmid
pKJprmhtrR GTCGTCCTCGTTGTCCCCGA

Karan et al.

Karan et al. BMC Biotechnology 2013 13:3   doi:10.1186/1472-6750-13-3

Open Data