Table 1

Primers used in this work (F: forward primer, R: reverse primer)
Primers Sequence (5’-3’) Source
A-F GGATCCATGAAGAAGAAGTCTCTGCT Amplification of lipA, BamHI site
A-R AAGCTTCTACAGGCTGGCGTTCTT Amplification of lipA, HindIII site
B-F GGGCATATGGTGAAGAAAATCCTCCTG Amplification of lipB, NdeI site
B-R CTCGAGTCAGCGCTGCTCGGCCT Amplification of lipB, XhoI site
AB-F CCTTGGATCCATGAAGAAGAAGTCTCTGCTCC Amplification of lipAB, BamHI site
AB-R CCTTAAGCTTCAGCTGCTCGGCCTGGCGCAT Amplification of lipAB, HindIII site

Wu et al.

Wu et al. BMC Biotechnology 2012 12:58   doi:10.1186/1472-6750-12-58

Open Data