Table 2

Primers used in this study

Primer

Sequence (5'-3')

Location 5'

Relative to


Msmeg1583-F1.2

GCGCCTTAAGCGACTGGGATCGCGAGAAGCTGC

+1067

Msmeg1583


Msmeg1583-R1

GCGCTCTAGACTCGTCCTCGTCGGCCGGCTTG

+1587

Msmeg1583


Msmeg1583-F2

GCGCAAGCTTGATCCATTTCACGCGACACCCCC

+1620

Msmeg1583


Msmeg1583-R2.1

GCGCACTAGTGGTGTTCGATCGTCTGGCCGATG

+2176

Msmeg1583


accD5E5-F

GATCTCATGAGTATGACAAGCGTTACC G

+1

Rv3280


accD5E5-R

GTCAAAGCTTTTATCGGCGCATGTGCG

+2161

Rv3280


accA3-F

GATCCCATGGGTATGGCTAGTCACGCC

+2

Rv3285


accA3-R

GTCAAAGCTTTTACTTGATCTCGGCGAGC

+1803

Rv3285


Rv2523-F

CATGCCATGGGCATCGTCGGTGTGGGG

+1

Rv2523


Rv2523-R

CCCAAGCTTACGGGGCCTCCAGGATGGC

+391

Rv2523


Restriction sites are presented in bold face. CTTAAG = EcoRI, TCTAGA = XbaI, CCATGG = NcoI, TCATGA = BspHI

AAGCTT = HindIII, ACTAGT = SpeI.

Noens et al. BMC Biotechnology 2011 11:27   doi:10.1186/1472-6750-11-27

Open Data