Table 1

Oligonucleotides used for creation of anti-IL12B shRNA expression cassettes

shRNA

Oligonucleotide sequence (target sequences are underlined)


shIL12B #1

Sense: 5'-ctagccc

    cctcacctgtgacacccct
actcgagaaggggtgtcacaggtgaggtttttggaaa-3'

Antisense: 5'-cgcgtttccaaaaacctcacctgtgacaccccttctcgagtaggggtgtcacaggtgaggggg-3'


shIL12B #2

Sense: 5'-ctagccc

    atgccagcattagcgtgcg
actcgagacgcacgctaatgctggcattttttggaaa-3'

Antisense: 5'-cgcgtttccaaaaaatgccagcattagcgtgcgtctcgagtcgcacgctaatgctggcatggg-3'


shIL12B #3

Sense: 5'-ctagccc

    ggtcttaggctctggcaaa
actcgagatttgccagagcctaagacctttttggaaa-3'

Antisense: 5'-cgcgtttccaaaaaggtcttaggctctggcaaatctcgagttttgccagagcctaagaccggg-3'


shIL12B #4

Sense: 5'-ctagccc

    ggaatttggtccactgata
actcgagatatcagtggaccaaattcctttttggaaa-3'

Antisense: 5'-cgcgtttccaaaaaggaatttggtccactgatatctcgagttatcagtggaccaaattccggg-3'


shIL12B #5

Sense: 5'-ctagccc

    gcagacagatgcaaagaaa
actcgagatttctttgcatctgtctgctttttggaaa-3'

Antisense: 5'-cgcgtttccaaaaagcagacagatgcaaagaaatctcgagttttctttgcatctgtctgcggg-3'


shIL12B #6

Sense: 5'-ctagccc

    gatgggaacgcaagagatact
actcgagaagtatctcttgcgttcccatctttttggaaa-3'

Antisense: 5'-cgcgtttccaaaaagatgggaacgcaagagatacttctcgagtagtatctcttgcgttcccatcggg-3'


shIL12B #7

Sense: 5'-ctagccc

    gggccttcatgctatttaa
actcgagattaaatagcatgaaggccctttttggaaa-3'

Antisense: 5'-cgcgtttccaaaaagggccttcatgctatttaatctcgagtttaaatagcatgaaggcccggg-3'


Bak et al. BMC Dermatology 2011 11:5   doi:10.1186/1471-5945-11-5

Open Data