Table 2

Primer sequences used for qPCR.

Gene

Sense Primer

Antisense Primer


ABCG2 [GenBank:NM_004827]

CACAAGGAAACACCAATGGCT

ACAGCTCCTTCAGTAAATGCCTTC

BMI-1 [GenBank:NM_005180]

AAATGCATCGAACGAGAATC

AATGAACCCTCCACAAAGCA

PECAM1 (CD31) [GenBank:BC051822]

GAGCACAGTGGCAACTACACG

GACCACGATGCTGCTGAC

PROM1 (CD133) [GenBank:NM_006017]

CATGTTTGGAGGATCTTGCTAGC

TTCCCGCACAGCCCC

NES [GenBank:BC108285]

CATTGTCCCCGTCGGTCTC

GAGGATGGACAGACGCGGC

RPL13a [GenBank:BC014167]

CCGAGAAGAACGTGGAGAAG

CTTTCAAGCAACTTCCGGAG

TERT [GenBank:NM_003219]

ACCGTCTGCAGGAGATC

GACCTGAGCTCGACGAC


Pascal et al. BMC Urology 2007 7:6   doi:10.1186/1471-2490-7-6

Open Data