Table 1

Primer pair sequences used in the study.

Gene

5' primer

3' primer


STC1

GACACTCAGGGAAAAGCATTCG

CTCATGGGATGTGCGTTTGAT

PENK

CAACTTCCTGGCTTGCGTAATG

AGGAACTTCTTTGGAGTAACTTTCGC

BMP2

CGGTCTCCTAAAGGTCGACCA

GTCACGGGGAATTTCGAGTTG

RAB27B

GGTTTATAATGCACAAGGACCGAA

CCACACACTGTTCCATTCGCT

MMP3

CTCACAGACCTGACTCGGTTCC

ATCGATTTTCCTCACGGTTGG

GALNT7

CTCAAGTCTGCTCTCAGCGAATATG

TTTTGGTAGATGTGTCCTACCCGA

TRO

GACACTCAGGGAAAAGCATTCG

CTCATGGGATGTGCGTTTGAT

RIS1

GTAAGCCCATTGAGTCCACGC

TCACTTGGTCGCCACCCCCGA

ChGn

TGCAGCAGTGCCTTTCGATAG

GTCGAAATAAGATGAGCCGTTTGA

TNC

CAGACATCACTGAAAATTCGGCTAC

GCAAAGATTCTCAGTGTGTATTCCG

EDNRB

GCAAACCGCAGAGATAATGACG

TCAAGATATTGGGACCGTTTCG

STC2

CAAGTCATTCATCAAAGACGCCTT

CCTTTCATTTCACCTCCGGATATC

BF

ACTCCATGGTCTTTGGCCCAG

AGTGGATTGCTCTGCACTCTG

GFRA1

ACAGCAGATTGTCAGATATATTCCGG

GCGAGATCTGCAGATGTAATTCG

IMPA2

TAGCATTGGATTTGCTGTTCGAC

TCCCGCCCATAGTTAATCGTCT

PTGIS

GGCTACCTGACTCTTTACGGAATTG

GGCTCTCACTCAGCACGCTATC

OSF2

CTGCTTATTGTTAACCCTATAAACGCC

TTGCTCTCCAAACCTCTACGGAT

EST

GAAGCAGAGCCATGACAATCG

CCATGACTTCCATGACAATCGTC

B2M

CACGTCATCCAGCAGAGAATGGAAAGTC

TGACCAAGATGTTGATGTTGGATAAGAG

╬▒SMA

GCCTCTGGACGCACAACTGGCATCG

GTTTGCTGATCCACATCTGCTGGAAGG


Goo et al. BMC Urology 2005 5:17   doi:10.1186/1471-2490-5-17

Open Data