Table 1

Primers used to clone microRNA precursors in this study

MicroRNA

5' primer

3' primer


miR-19a

GCATCTACTGCAGTGAAGGC

GCGGCCGCAGTTTGATTGGGCGACAGG


miR-491

AGATGGCTTTCTGGGTAGCC

GCGGCCGCTAACAGTAACACGTATGGGC


miR-296

CCTCCTTGGAGCTGAGATGG

GCGGCCGCGTGGGAGGTAGGTAAAACTC


miR-532

CATCTGTTCTCGTATGTGTG

GCGGCCGCACGTAAGAGAGGGTTTACC


miR-188

CTTCCCTCTCCAGTGCATAG

GCGGCCGCTCCTGCAGGATCCATGTAAG


miR-579

CAGTGACAGAGTTGTGTAAC

GCGGCCGCGTGGAAACAAGTTGCATGTC


miR-501

AGACCCTCAAGTGTGATCTG

GCGGCCGCAGTATATGCAGGGGCAATG


miR-548c

TCAGGGTTTCACCATGTTGG

GCGGCCGCACAGAGCAAGACTCCATCTC


miR-219-1

CGTTTACTCTAGAGTCCTCG

GCGGCCGCACAGAGGGCTCGTGAAAAGG


miR-340

TGGCTACCTGTTCAGCTTTC

GCGGCCGCAGCAGTTTACCAGAATACCG


miR-519b

CTGGACACAAAACTCAGGAG

GCGGCCGCGTCTGGGTCACAGAGCAAG


miR-155

TGCCTAAAGGTAACAATGTC

GCGGCCGCGGTTGAACATCCCAGTGAC


miR-519e

GGTATGTGTGGTAGGCTTTG

GCGGCCGCAACTAGCCTAAGAGGTCTAG


miR-515-1

TACATGCCACCACAGGCGGC

GCGGCCGCCTGGGCCACAGAGAGAGAC


miR-139

GATCGTGCAGGCAACTCTTG

GCGGCCGCTGGATAACAAGGCAGTATGG


miR-494

TTCCCGGGCAACCTCTTTTC

GCGGCCGCTCCTTCAACCACAGAAGCAC


miR-203

CGTCTAAGGCGTCCGGTACG

GCGGCCGCTTCCCACAGCACAGCCCGGC


miR-142

GATGGGGTGGAGCCTTTAGG

GCGGCCGCAACCAGGAAGGGCAGGAAAG


miR-450-1

TGATTATCTCTGAGTTGTGG

GCGGCCGCAAAATGATCCCAATACAC


miR-193a

AGTTTCTCGGCGCATAACTC

GCGGCCGCTATTTCTCCAGCGAAGTG


miR-193b

GTTGTCCGGGAAGCTTTTAG

GCGGCCGCCCTCGAAGGGACCTTTTAG


miR-487b

TGGTCTGGGTCCCTGCTTCC

GCGGCCGCAGTCATAAAACCACCACCAC


miR-487a

CAGTCTCATGAGGGAGTGCC

GCGGCCGCTCTCACTGGTCAACTTCCC


miR-301

AGGGCTTGTTTTACATGGCG

GCGGCCGCCAGACGTGTTTCATAATGC


miR-130a

CTGCTTTAGTGGGTCCTGTC

GCGGCCGCTAACGGAGGCAGTGTCTATC


miR-130b

GTCAAAGCATCTGGGACCAG

GCGGCCGCACCTGATCCTCTGATGGAG


miR-148a

CTTTGCTGTGACATTGCGAC

GCGGCCGCTTTGGGGGGATTTTGTTCCC


miR-503

CTCGTGGGGAAGGTAGAAGG

GCGGCCGCAAGATAGGTTTTCTTCGTTG


miR-152

AGCAGCCAACTCAGAACTCG

GCGGCCGCAAGGTCCACAGCTGGTTCTG


miR-95

CCTCCTGAGGAATCCAGGCG

GCGGCCGCGATCGGGCCCTTGCGAAGCC


miR-550

GAGCCTTCTAACCACAACCC

GCGGCCGCATAAAGCAGTTCCTACACTC


miR-545

TCATGCCAGTGTCTAGTTCC

GCGGCCGCCACCAAGAAAGCAAGTGTC


miR-424

ACCCACTACGTTGTTCCAAG

GCGGCCGCAGAGCACCGATCGCTCACTG


miR-15a

AAAGGTGTACTGCAAGGAAC

GCGGCCGCACTGCTGACATTGCTATC


miR-16

GCTAGGTTGGATGAATCCTAC

GCGGCCGCCATCCAAAGTGTTACAAAG


miR-497

CCTGAGCTGAGTTCCTACAG

GCGGCCGCGTGTGGGCAACAAAGACTCC


miR-195

GTGACACAAAAAACATCTGG

GCGGCCGCATAAGCATCTGCCCCCAACC


miR-515-2

CGAGTAGCTGGGACTACAGG

GCGGCCGCATACCAGCTACTCGGGAGGC


miR-144

ATTACGCCATCTCTGGCTTG

GCGGCCGCACGTTTTCTGGGTATAGC


miR-34a

ATGGAGTCTTGCTAGTTGCC

GCGGCCGCTACGTGCAAACTTCTCCCAG


miR-449a

TTGAAGTAATACATTTTGTG

GCGGCCGCACTGTCTACTCCGAAAGAC


miR-146a

GTAGAGACAAATTCTCCATG

GCGGCCGCTTTCTCACAGGAACTCACAC


miR-655

AATCCGTGGAGGAAGCTTTC

GCGGCCGCACAGCAAACACAGCAAAGC


miR-374

GTTCCTTTATTGGAAGTCTG

GCGGCCGCAGGCACACAATAAATGTTTG


miR-524

AGTAGAGACAGGGTTTCACC

GCGGCCGCGATAGAGAGACTCTGTCCGC


miR-520d

CTGGTGTCTAACTCCTGAGA

GCGGCCGCTGACCATTTGAAGCCAAGAG


miR-376a-1

CCTGAGTAGGTGCAAAGATG

GCGGCCGCATTATGTGTGCACCAAGGGC


miR-23b

AATTGTGTGTGTCGCATGGC

GCGGCCGCGGTGCAGAACTTAGCCACTG


miR-23a

GCCATGCAAGTTGCTGTAGC

GCGGCCGCTTCCTGCTGAACTGAGCCAG


miR-199a-2

AGCGCATACCCAAACCTCCC

GCGGCCGCGTCAAGAAGGCCTTACCCGC


miR-199b

GGGGTTGGACACTAGGTAGG

GCGGCCGCAGGTTTTGGGGTGAGGGAGG


miR-194-1

CTAATGGCATTATCTCACAG

GCGGCCGCGATGACTTTAATCCTCTTCC


miR-202

CCTGCGCATAAATGTGGAGC

GCGGCCGCTCCTCTCTGCATCCTGGGTC


miR-875

TATACCTCAGTTTTATCAGGTG

GCGGCCGCGTGCATAGCTTCTGTAAAGG


miR-511-1

AATGGCCTCTAGTTGCATCC

GCGGCCGCATAGATCACTTACCTGAGGG


Jiang et al. BMC Cancer 2009 9:194   doi:10.1186/1471-2407-9-194

Open Data