Table 1

Synthetic oligonucleotides used in MSE and conventional bisulfite-DGGE

Primer name

sequence

Tm


A. The nested PCR primer set

MUC1

Forward:

5'-AAAGGGGGAGGTTAGTTGGA-3'

63

Reverse:

5'-TACCCCTCACCTATAAACAC-3'

MUC2

Forward:

5'-TTTGGGGTTAGGTTTGGAAG-3'

59

Reverse:

5'-ACCTTCTTCAAAATAAAACAACC-3'

MUC3A

Forward:

5'-TTGAGGGATAGAAGGGGTTTG-3'

64

Reverse:

5'-AACCCCAACAACTACATAAACCC-3'

MUC4

Forward:

5'-AGAGTAAGGGGTGTATGGGTG-3'

60

Reverse:

5'-ACTCCACTACCCAACAACTAC-3'

MUC5AC

Forward:

5'-AAAGTTTTGGGTGTGTGGAG-3'

62

Reverse:

5'-ATCAATATCCAACCCCCAAC-3'

MUC17

Forward:

5'-ATAAAGGGGGTGTTTTTGTTAGG-3'

62

Reverse:

5'-AAACAAACAAAACAAACTAACCCC-3'

B. The target PCR primer set

MUC1

Forward:

5'-[GC CLAMP]AAGAGGTAGGAGGTAGGGGA-3'

53

Reverse:

5'-AAAACAAAACAAATTCAAAC-3'

MUC2

Forward:

5'-[GC CLAMP]TTTTAGAGTTTGGGTTTTAG-3'

51

Reverse:

5'-TAACCTAAATACCAACACAC-3'

MUC3A

Forward:

5'-[GC CLAMP]TTTTAGGTAGTTTTATGTGG-3'

52

Reverse:

5'-AACAAAAAACTAAAACAAAAC-3'

MUC4

Forward:

5'-[GC CLAMP] AGGAGAGAAAAGGGTGATTAG -3'

57

Reverse:

5'-ACTCCACTACCCAACAACTAC-3'

MUC5AC

Forward:

5'-[GC CLAMP]TTTATGTTTAGGGGTTTTGG-3'

62

Reverse:

5'-ACCAACTAACCACCCAAACC-3'

MUC17

Forward:

5'-[GC CLAMP]ATTTTTATGTTTATGGGTTG-3'

53

Reverse:

5'-ATAATCCCTAACCTTAACATC-3'


*[GC CLAMP]:5'-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG-3'

Yokoyama et al. BMC Cancer 2012 12:67   doi:10.1186/1471-2407-12-67

Open Data