Table 2

Information of the oligonucleotides used for the qRT-PCR analysis

Gene Name

Sequence Accession Number

Primer Sequence

Primer Location (Exon

Prod. Length

T°a


WNT7A

Wingless-type MMTV integration site family, member 7A

NM_004625

F CAAAGAGAAGCAAGGCCAGTA

R GTAGCCCAGCTCCCGAAACTG

707-730 (3)

962-983 (4)

277

60


MYC

V-myc myelocytomatosis viral oncogene homolog (avian)

NM_002467.4

F CCAGCGCCTTCTCTCCGTC

R GGGAGGCGCTGCGTAGTTGT

1208-1226 (2)

1490-1509 (3)

302

60


JUN

Jun proto-oncogene

NM_002228.3

F TGGAAAGTACTCCCCTAACCT

R CTGAAACATCGCACTATCCTT

2786-2806 (1)

3015-3035 (1)

250

60


FRA-1

FOS-like antigen 1

NM_005438.3

F AGGAACCGGAGGAAGGAACTG

R TGCCACTGGTACTGCCTGTGT

554-574 (3)

732-752 (4)

199

60


AXIN2

Axin 2

NM_004655.3

F AAAAAGGGAAATTATAGGTATTAC

R CGATTCTTCCTTAGACTTTG

2678-2701 (10/11)

2935-2954 (11)

277

54


GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

NM_002046.3

F CACTGCCACCCAGAAGACTGTG

R TGTAGGCCATGAGGTCCACCAC

645-666 (8)

1072-1089 (9)

449

63


RPL32

Ribosomal protein L32

NM_000994.3

F GACTTGACAACAGGGTTCGTAG

R ATTTAAACAGAAAACGTGCACA

213-234 (3)

511-532 (4)

320

60


RPS18

Ribosomal protein S18

NM_022551.2

F CGATGGGCGGCGGAAAA

R CAGTCGCTCCAGGTCTTCACGG

105-121 (2)

366-387 (5)

283

58


B2M

Beta-2-microglobulin

NM_004048.2

F GAGGCTATCCAGCGTACTCCAA

R CACACGGCAGGCATACTCAT

115-136 (1/2)

347-366 (2)

252

58


ACTB

Actin beta

NM_001101.3

F TCCGCAAAGACCTGTACG

R AAGAAAGGGTGTAACGCAACTA

950-967 (5)

1226-1247 (6)

298

60


Ochoa-Hernández et al. BMC Cancer 2012 12:60   doi:10.1186/1471-2407-12-60

Open Data