Table 1

Oligonucleotide primers used for analysis of RT-PCR and qRT-PCR expression of androgen receptor-responsive genes and PCA3 transcript
Gene Primer 5’ – 3’
PMEPA1-F CATGATCCCCGAGCTGCT
PMEPA1-R TGATCTGAACAAACTCCAGCTCC
18S-F* AACCCGTTGAACCCCATT
18S-R* CGCTACTACCGATTGGATGG
GAPDH-F* TGACCCCTTCATTGACCTCA
GAPDH-R* AGTCCTTCCACGATACCAAA
TMPRSS2-F CTGGTGGCTGATAGGGGATA
TMPRSS2-R GGACAAGGGGTTAGGGAGAG
NDRG1-F CGAGACTTTACATGGCTCTG
NDRG1-R GCATTGATGAACAGGTGCAG
GREB1-F AAGGAGGGCTGGAAACAAAT
GREB1-R CATTGTGGCCATTGTCATCT
PSA-F TGCATCAGGAACAAAAGCGTGA
PSA-R CCTGAGGCGTAGCAGGTGGTCCCCAG
AR-F CCACTCGTCTCACGGGATAG
AR-R GAAGACCTTGCAGCTTCCAC
FGF8-F CAACTCTACAGCCGCACCAGC
FGF8-R TGCTCTTGGCGATCAGCTTC
Cdk1-F AAGTGAAGAGGAAGGGGTTCC
CdK1-R CCAAAAGCTCTGGCAAGGCC
CdK2-F ATGGGTGTAAGTACGAACAGG
CdK2-R TTCTGCCATTCTCATCGG
PCA3 : 69-F AGATTTGTGTGGCTGCAGC
PCA3 : 510-R TCCTGCCCATCCTTTAAGG

*Also shown are the oligonucleotides used for analysis of constitutive gene expression.

Ferreira et al.

Ferreira et al. BMC Cancer 2012 12:507   doi:10.1186/1471-2407-12-507

Open Data