Table 1

Real time RT-PCR primers
Genes Forward and reverse primer Product length (bp)
SPARC F: 5-ACATAAGCCCAGTTCATCACCA-3 278
R: 5-ACAACCGATTCACCAACTCCA-3
E-cadherin F: 5-GGATTGCAAATTCCTGCCATTC-3 147
R: 5-AACGTTGTCCCGGGTGTCA-3
β-catenin F: 5-GCTGATCTTGGACTTGATATTGGTG -3 117
R: 5- GTCCATACCCAAGGCATCCTG -3
α-catenin F: 5- CTCTACTGCCACCAGCTGAACATC -3 154
R: 5- ATGCCTTCACTGTCTGCACCAC -3
Integrin β3 F: 5-TTCAATGCCACCTGCCTCAA-3 98
R: 5-TTGGCCTCAATGCTGAAGCTC-3
Integrin β1 F: 5-CAAGCAGGGCCAAATTGTGG-3 185
R: 5-CCTTTGCTACGGTTGGTTACATT-3
ILK F: 5- CCAATGTCCTGGTCGCATGTA -3 132
R: 5- CGTGTCACCAGTTCCCACAGA -3
FAK F: 5-CTGGCAGCATCTATCCAGGTCA-3 144
R: 5-TTGGCAACACTTGCCCAATC-3
P53 F: 5- AACGGTACTCCGCCACC-3 94
R: 5- CGTGTCACCGTCGTGGA-3
P21 F: 5- CACTCAGAGGAGGAAAATCCAGT −3 90
R: 5- TTCTGACATGGCGCCTGCCT −3
Cyclin D1 F: 5-CCGAGAAGCTGTGCATCTACAC-3 94
R: 5-AGGTTCCACTTGAGCTTGTTCAC-3
PCNA F: 5- CTGTAGCGGCGTTGT -3 133
R: 5- ACTTTCTCCTGGTTTGG -3
Bcl-2 F: 5- TCAGGGACGGGGTGAACT -3 143
R: 5- CAGGTGCCGGTTCAGGTACTC -3
Bax F: 5- CGCCGTGGACACAGACTC -3 108
R: 5- GCAAAGTAGAAAAGGGCGACAAC -3
u-PA F: 5-TCTGCCTGCCCTCGATGTATAAC-3 179
R: 5-GGTGGTGACTTCAGAGCCGTAGTAG-3
PAI-1 F: 5-GGTCTCCAAACCAGACGGTGA-3 188
R: 5-TGGCAATGTGACTGGAACAGAAATA-3
uPAR F: 5- ATCACCAGCCTTACCGAGGTTG -3 87
F: 5- ACGGCTTCGGGAATAGGTGAC -3
MMP2 F: 5-TGACATCAAGGGCATTCAGGAG-3 134
R: 5-TCTGAGCGATGCCATCAAATACA-3
MMP9 F: 5- CGCCCATTTCGACGATGAC -3 80
R: 5- CGCCATCTGCGTTTCCAA -3
TIMP1 F: 5- ACAGACGGCCTTCTGCAATTC-3 166
R: 5- GGTGTAGACGAACCGGATGTCA -3
TIMP2 F: 5- GTTCAAAGGGCCTGAGAAGGA -3 166
R: 5- CCAGGGCACGATGAAGTCA-3
GAPDH F: 5- GGGAAACTGTGGCGTGAT -3 299
R: 5- GAGTGGGTGTCGCTGTTGA -3

Chen et al.

Chen et al. BMC Cancer 2012 12:464   doi:10.1186/1471-2407-12-464

Open Data