Additional file 2.

Figure S1. The expression level of MMP-2 and MMP-7. A, Real-time PCR quantification of MMP-2 and MMP-7 mRNA expression levels in Bmi-1-overexpressing and Bmi-1-silencing cells. MMP-2 and MMP-7 expression levels are presented as fold changes relative to vector-control cells and normalized to GAPDH. The primiers, MMP-2-up: CAGGGAATGAGTACTGGGTCTATT; MMP-2-dn: ACTCCAGTTAAAGGCAGCATCTAC;

    MMP-7-up
    :
AGCCAAACTCAAGGAGATGC;
    MMP-7-dn
    :
ACTCCACATCTGGGCTTCTG. B, ELISA assay of secreted MMP-2 and MMP-7 protein activity in cell supernatants. Error bars represent the mean ± SD of three independent experiments.

Format: TIFF Size: 220KB Download file

Jiang et al. BMC Cancer 2012 12:406   doi:10.1186/1471-2407-12-406