Table 1

Primer Sequences
Primer Species Sequence (5′- 3′) TM (°C)
Hornerin Human Forward: TTCGTCTTCCAGCTATGGTCAGCA 60
Reverse: AGTAACTTGAGCCAGACCCGTGTT
Hornerin Murine Forward: TCTCAACGGTTTGGATCTGGCTCA 60
Reverse: TGTTGACTGCCTTCTGTCTGTCCA
GAPDH Human/Murine Forward: CCCTCCATTGACCTCAACTAC 60
Reverse: CCACCTTCTTGATGTCATCAT

Fleming et al.

Fleming et al. BMC Cancer 2012 12:266   doi:10.1186/1471-2407-12-266

Open Data