Table 1

Sequences of the PCR and pyrosequencing primers used in this study
Gene symbol

Primer sequences (5´-3´) *

F: PCR forward; R: PCR reverse;

S: pyrosequencing; bio: biotinylation

Amplicon length, bp Number of CpGs quantified by pyrosequencing Reference
CDH1-F TTTTTTTTGATTTTAGGTTTTAGTGAG 421 [29]
CDH1-R bio-ACTCCAAAAACCCATAACTAACC
CDH1-S AGTTAGTTTAGATTTTAGTT 9 this study
DACT1-F GTTTGGGAAGTGAAAGAAATTTAATT 184 [30]
DACT1-R bio-CTAAAACCCCAACATCCTATTACAAT
DACT1-S AGATTGTGTTGTAATTTGGT 5 this study
DKK1-F bio-GGGGTGAAGAGTGTTAAAGGTT 326 [31]
DKK1-R AAACCATCATCTCAAAAAAACTCAA
DKK1-S CTACAAAAAACACAAAACTCTAC 8 this study
DKK2-F bio-TTTTAGTAGTTGTGGGTGGAGATA 456 this study
DKK2-R ATACTCCTTTTCAAAATTAACAAAC
DKK2-S CCTAACTCACAAAAAACAAC 11
DKK3-F GATTTTGTTGAGTTTAGTTTTTTTTGGT 123 [32]
DKK3-R bio-CAAACCTCTCTCAACCCCTACCTA
DKK3-S TTTTTTGGTGGATGTG 5 this study
DKK4-F bio-ATAGATTTGAAGGGATTTGTTGAAGTTT 328 [33]
DKK4-R CAAAACCAACTCAACCCCAACAAAAC
DKK4-S CTAAACTAACAACTCAACAC 2 this study
SFRP1-F TTTTTAAGGGGTGTTGAGT 412 [16]
SFRP1-R CAAACTTCCAAAAACCTCC
SFRP1-S GGAGTTGATTGGTTG (Sanger sequencing) this study
SFRP2-F ATGTTTGGTAATTTAGTAGAAATTT 409 this study
SFRP2-R bio-CAACCAAAATTTTCTTAACCTTTTT
SFRP2-S GATTGGGGTAAAATAAGTT 14
SFRP3-F bio-GTGATTTAGGGGAGGAGATATTTTAGA 542 this study
SFRP3-R TTCCAAAACAAAAACTTACACAAAA
SFRP3-S CAAAATAAAACAAAATACAAC 4
SFRP4-F bio-GTGTTTTGTGTGTTAGA 220 [16]
SFRP4-R CCACTAAAATAAAAAAAAACATAACA
SFRP4-S TACCACCCTCATCTTTC 2 this study
SFRP5-F GTAGGGAGTTTTGGGGAGAAA 272 [16]
SFRP5-R bio-CCCAAATAAATAACAACCTAC
SFRP5-S GTTTTGGAGTTGGGGTTAG 8 this study
WIF1-F bio-GAGTGATGTTTTAGGGGTTT 414 [34]
WIF1-R CCTAAATACCAAAAAACCTAC
WIF1-S AAACTACATTCACAATAC 7 this study

* Primers of the same sequence but without biotin modification were employed for amplification of the PCR-products used for subcloning and bisulphite sequencing.

Moskalev et al.

Moskalev et al. BMC Cancer 2012 12:213   doi:10.1186/1471-2407-12-213

Open Data