Table 2

Primers and probes for target and reference genes for expression levels and copy number studies

Gene

Name

Primers (F, R) and probe (Z) sequences

5' → 3'

Amplicon

lengh


Target genes

RBSP3/CTDSPL

NM_001008392

RBSP3 (RB1 serine phosphatase from human chromosome 3), CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A)

small phosphatase-like

cDNA

F: GCGAGAAAGCCTCCCAGTG

R: CCACCATTCTCCTCCACCAGT

Z: CCACATTGTAATCACGGAAGCAGCAGA

154

DNA

F: CAGAGTGCGTGTGCCGACT

R: ACAACTTCTCTGCGGGCGT

Z: CTGGCGGAGAGACTGGGAGCGA

126

NPRL2/G21

NM_006545

Nitrogen permease regulator-like 2 gene

cDNA

F: GGACCTCACTACACAACAAATCCTG

R: GTCACAACGCCGTAGTACAGCA

Z: ACATCCAGAAGATTTCAGCAGAGGCAGAT

134

RASSF1A

NM_007182

Ras association (RalGDS/AF-6) domain family 1

cDNA

F: CGCGCATTGCAAGTTCAC

R: AGGCTCGTCCACGTTCGT

Z: CGCTCGTCTGCCTGGACTGTTGC

120

Reference genes

RPN1

NM_002950

Ribophorin I

cDNA

F: CACCCTCAACAGTGGCAAGAAG

R: TGCATTTCGCTCACTCTGTCG

Z: CCCTCTGTCTTCAGCCTGGACTGC

125

DNA

F: TATGGGCCTTTCAGAGATGTGCCT

R: ACCACCCAAGCCTATCAACCAGTA

Z: TGGAGTCCAGCCCATCCCTGTCTGCTTCA

120

GUSB

NM_000181

Glucuronidase, beta

β-D-glucuronidase

cDNA

F: GATGGAAGAAGTGGTGCGTAGG

R: TTAGAGTTGCTCACAAAGGTCACAG

Z: CGTCCCACCTAGAATCTGCTGGCTACTACTT

171

DNA

F: TGCCGTGAGTCTCTGCTGTG

R: CCTACGCACCACTTCTTCCATC

Z: TGACCCTCTGTCCCTTCCCTCCTG

151

ACTB

NM_001101

Actin, ß

DNA

F: GTGCTCAGGGCTTCTTGTCCTTT

R: TTTCTCCATGTCGTCCCAGTTGGT

Z: AAGGATTCCTATGTGGGCGACGAGGCCCA

160

GAPDH

NM_002046

Glyceraldehyde-3-phosphate dehydrogenase

cDNA

F: GGAGTCAACGGATTTGGTC

R: TGGGTGGAATCATATTGGAACAT

Z: CCTTCATTGACCTCAACTACATGGTTTACAT

139


Senchenko et al. BMC Cancer 2010 10:75   doi:10.1186/1471-2407-10-75

Open Data