Table 1

Northern blot probe primers

Gene symbol

Primer sequence


ARMER

F-primer

CGGAGGGAGATAATCGCAGCACCAAC

R-primer

GAAGCAGGTTGTGGACTTGTTGTCCC

PCBP1

F-primer

CGCCGGAATTGACTCCAGCTCTCC

R-primer

CAGAAAGGGGTTATTGAGGGAACCTAC

PDHB

F-primer

CGGTGTCTGGCTTGGTGCGGAGAC

R-primer

GAGTTTATAACCTGGTCAATGGCTTGC

FUBI

F-primer

TTTCAGATTCTAGAGTTATGTCCTC

R-primer

ATAGAATGGGATGCTGTCTGGGAA

β-actin

F-primer

CGCGCTCGTCGTCGACAACGGC

R-primer

CGTACATGGCTGGGGTGTTGAAGGTC


Cao et al. BMC Cancer 2010 10:68   doi:10.1186/1471-2407-10-68

Open Data