Table 1

Primer sequences and PCR conditions used for analysis of GATA4 mutations

GATA4 exons

Exon size (bp)

Primer

Primer length

Primer sequence (5'-3')

Melting temperature

PCR product length (bp)


exon 1

61

GT4x1F

20

cttgcacgtgactcccacag

65°C

250

GT4x1R

20

aagcaaaggcggagaagctc

exon 2

1073

GT4x2-1F

21

tctctttctgtcgttcctctt

65°C

600

GT4x2-1R

20

gcacgtagactggcgaggac

GT4x2-2F

21

ggaccatgtatcagagcttgg

65°C

641

GT4x2-2R

20

gccctcgcgctcctactcac

exon 3

167

GT4x3F

24

agtcagagtgaggaagagcaagag

65°C

541

GT4x3R

21

cagtttctgtgtgccgaagag

exon 4

126

GT4x4F

20

ccagccctgcctcccgttag

65°C

294

GT4x4R

23

gaggactgagagatgggcatcag

exon 5

88

GT4x5F

22

agtagccatcacatcacacagg

65°C

504

GT4x5R

19

aaagctcccaacacgttcc

exon 6

149

GT4x6F

20

gtttgtccctgccgctgatt

65°C

247

GT4x6R

20

gcagtcggcctccccacaaa

exon 7

1708

GTx7-1F

19

acaaggctatgcgtctccc

60°C

289

GTx7-1R

20

ctgagaaaatccaacacccg

GT4x7-2F

20

gcgtaatcttccctcttccc

65°C

291

GT4x7-2R

19

gggacaaggacatcttggg

GTx7-3F

20

gtcgacaatctggttagggg

60°C

281

GTx7-3R

20

gtacatggcaaacagatgcc

GTx7-4F

20

gaggatctgagaacaagcgg

60°C

270

GTx7-4R

20

cagctgcattttgatgaggc

GTx7-5F

22

aaattgtggggtgtgacataca

60 °C

577

GTx7-5R

22

gttgcagaatctctggcttttt

GTx7-6F

22

ctgtctgtctgctcctcctagc

65°C

586

GTx7-6R

22

acctcccagtgaagaccactaa


Reamon-Buettner et al. BMC Medical Genetics 2007 8:38   doi:10.1186/1471-2350-8-38

Open Data