Table 1

Primers used for amplification of the ABCB1 and CYP2C19 polymorphisms

Name

Primer sequence

Fragment size (bp)

Anelling temperature (°C)


ABCB1c.C3435T F

5' GGGTGGTGTCACAGGAAGAG3'

74

59.6

ABCB1c.C3435T R

5' CCTTCATCGAGTCACTGCCT 3'

CYP2C19*2 F

5' TGCAATAATTTTCCCACTATCA 3'

83

50.5

CYP2C19*2 R

5' CCTTGCTTTTATGGAAAGTGA 3'

CYP2C19*3 F

5' CCTTGCTTTTATGGAAAGTGA 3'

75

50.5

CYP2C19*3 R

5' TTTTTGCTTCCTGAGAAACCA 3'

CYP2C19*4 F

5' GCAAGCTCACGGTTGTCTTA 3'

70

63.4

CYP2C19*4 R

5' TGTGGTCCTTGTGCTCTGTC 3'

CYP2C19*5 F

5' TGGAAGTTGTTTTGTTTTGCT 3'

110

59.6

CYP2C19*5 R

5' TAAGAGATAATGCGCCACGA 3'

CYP2C19*17 F

5' AAATTTGTGTCTTCTGTTCTCAAA 3'

100

56.7

CYP2C19*17 R

5' AATCCCAGTTCTGCCAGCTA 3'


Santos et al. BMC Medical Genetics 2011 12:13   doi:10.1186/1471-2350-12-13

Open Data