Table 1

Primers, probes and restriction enzymes

Gene

SNP

Sense primer

Antisense primer

Probe/restriction enzyme


TNF-α

G- 308 A

5'-TAGGTTTTGAGGGGCATGGGGAC-3'

5'- TCTCGGTTTCTTCTCCATCG -3'

5'-TAGGTTTTGAGGGGCATGGGGAC-3'-fluorescein

5'-LC Red640-GGGTTCAGCCTCCAGGGTCCTACACAC-3'-phosphate

Il-1β

C3953T

5'-CACTCCCAGCTTCATCCCTA-3'

5'-AGGTGCATCGTGCACATAAG-3'

Taq I

PAI-1

4G/5G

5G allele; 5 ' -GTCTGGACACGTGGGGG-3 ' 4G allele; 5 ' -GTCTGGACACGTGGGGA-3 '

5 ' -TGCAGCCAGCCACGTGATTGTCTAG-3 '

None

uPA

C 422 T

5'-biotin-ACTGCAGGAACCCAGACAAC-3'

5'-AGGGAGGCAGGTAGGAGAAA-3'

5'-GCCTAAAGC

    C
GCTTGTCCAA-3' 5'-GGCCTAAAGC
    T
GCTTGTCCAA-3'

TLR4

A 896G

5'-biotin-AGTCCATCGTTTGGTTCTGG-3'

5'-AATAGTCACACTCACCAGGGAAA-3'

5'-AGTCAATAATA

    T
CATCGAGGTAG-3' 5'-AGTCAATAATA
    C
CATCGAGGTAG-3'

CD14

C-159T

5'-biotin-CACCCACCAGAGAAGGCTTA-3'

5'-ATCACCTCCCCACCTCTCTT-3'

5'-GGAGGGGG

    G
CCGTAACA-3' 5'-GGGAGGGGG
    A
CCGTAACAG-3'


TNF-α: tumor necrosis factor alpha; Il-1β: interleukin-1 beta; PAI-1: plasminogen activator inhibitor 1; uPA: urokinase-type plasminogen activator; TLR4: toll-like receptor 4; CD14: cluster of differentiation 14; A: adenine; T: thymidine; C: cytosine; G: guanine; SNP: single nucleotide polymorphism; LC: light cycler

Jessen et al. BMC Infectious Diseases 2007 7:108   doi:10.1186/1471-2334-7-108

Open Data