Table 1

Primers and probes for multiplex qPCR
Organism Target Oligo function Oligo name Sequence 5'-3'a
B. pseudomallei + ISBma2 primer Bumcpri_f GCGGAAGCGGAAAAAGGG
B. mallei ISBma2transposase primer Bumcpri_r GCGGGTAGTCGAAGCTG
probe Tqpro_Bumc FAM-TCRCCAGACGCAGCAGCAT-BHQ1
B. pseudomallei Hypothetical primer psupri_f GCGCGATCCGTCGAG
protein primer psupri_r AGCCGCTACGACGATTATG
probe Tqpro_psu JOE-CCGCGACAATACGACCATCC-BHQ1
B. mallei Hypothetical primer maupri3_f GGCGAAAGAACGCGAAC
protein primer maupri3_r GCGTTCCACGATCAACTCT
probe Tqpro2_mau CF590-CATCCCGCACCGTCCG-BHQ2
B. thuringiensis Crystal protein primer Btpri_f GCAACTATGAGTAGTGGGAGTAATTTAC
gene primer Btpri_r TTCATTGCCTGAATTGAAGACATGAG
probe Tqpro_Bt Cy5-ACGTAAATACACT-BHQ2-TGATCCATTTGAAAAG-P

a CFR590= CalFluor Red 590, BHQ= Black Hole quencher, P= phosporylation.

Janse et al.

Janse et al. BMC Infectious Diseases 2013 13:86   doi:10.1186/1471-2334-13-86

Open Data