Table 1

Primer sequences and probes used in real-time PCR assay
Gene Primer and probe sequence (5′to3′) Product length(bp) GenBank
EV71 (R) CCCGCTCTGCTGAAGAAACT 89 AF302996
(F)AGTGATGAGAGTATGATTGAGACACG
(P) TCGCACAGCACAGCTGAGACCACTC
β-actin (R) CAAGTACTCCGTGTGGATCG 90 NM_001101.3
(F) GGATGCAGAAGGAGATCACTG
(P) CCCTGGCACCCAGCACAATGA
RIG-1 (R) CCTCTGCACTGTTGCTCAGGAC 192 NM_004585.3
(F) CTCTTGGCTTCGAGATGGCTTC
MDA5 (R) ATTGGTGACGAGACCATAACGGATA 196 NM_022168.2
(F) AGGAGTCAAAGCCCACCATCTG
TLR2 (R) CACAAAGTATGTGGCATTGTCCAG 158 NM_003264.3
(F) GTGTTGCAAGCAGGATCCAAAG
TLR3 (R) AGTGCCGTCTATTTGCCACACA 181 NM_003265.2
(F) AACAGTGCACTTGGTGGTGGAG
TLR4 (R) ATGCGGACACACACACTTTCAAATA 143 NM_138554.3
(F) TTGAGCAGGTCTAGGGTGATTGAAC
TLR6 (R) AGCCTTCAGCTTGTGGTACTTGTTG 138 NM_006068.2
(F) CAGAGTGAGTGGTGCCATTACGA
TLR7 (R) TCTTCAACCAGACCTCTACATTCCA 172 NM_016562.3
(F) GGAACATCCAGAGTGACATCACAG
TLR8 (R) GATTGCTGCACTCTGCAATAACTGA 196 NM_138636.3
(F) GCTGCTGCAAGTTACGGAATGA
TLR9 (R) CAGGGCCTTCAGCTGGTTTC 97 NM_017442.2
(F) CCGTGACAATTACCTGGCCTTC
TLR10 (R) TGTGTTGCAAGATAATTCGTGGAGA 103 NM_001017388.1
(F) CATGATGGTTGGATGGTCAGATTC
β-actin (R) CTAAGTCATAGTCCGCCTAGAAGCA 186 NM_001101.3
(F) TGGCACCCAGCACAATGAA

Gong et al.

Gong et al. BMC Infectious Diseases 2012 12:224   doi:10.1186/1471-2334-12-224

Open Data