Table 2

Primers used to amplify the tetracycline and macrolide resistance determinants and for sequencing purpose

Primer

Sequence (5' - 3')

Product size

Position in coding sequence

Reference


erm(A)-F

CCCGAAAAATACGCAAAATTTCAT

590

15-38

[23]

erm(A)-R

CCCTGTTTACCCATTTATAAACG

604-582

erm(B)-F

TGGTATTCCAAATGCGTAATG

745

203-183

erm(B)-R

CTGTGGTATGGCGGGTAAGT

541-522

mef(A)-F*

CAATATGGGCAGGGCAAG

317

38-55

mef(A)-R*

AAGCTGTTCCAATGCTACGG

352-333

tet(M)-F

GTGGACAAAGGTACAACGAG

406

106-125

tet(M)-R

CGGTAAAGTTCGTCACACAC

511-492

tet(O)- F

AACTTAGGCATTCTGGCTCAC

515

13-43

tet(O)- R

TCCCACTGTTCCATATCGTCA

527-507

tet(K)-F

GATCAATTGTAGCTTTAGGTGAAGG

155

344-368

tet(K)-R

TTTTGTTGATTTACCAGGTACCATT

498-474

tet(L)-F

TGGTGGAATGATAGCCCATT

229

384-403

tet(L)-R

CAGGAATGACAGCACGCTAA

612-593

16S-rDNA-F

GAGTACGACCGCAAGGTTGA

100

886-905

16S-rDNA -R

CTGGTAAGGTTCTTCGCGTTG

985-964


ss-Tn916-1

GCCATGACCTATCTTATA

476

16083-16100

[24]

ss-Tn916-2

CTAGATTGCGTCCAA

16559-16545


tet(32)For

GAACCAGATGCTGCTCTT

620

619-637

[28]

Tet(32)Rev

CATAGCCACGCCCACATGAT

1239-1220


SScps2J-F

CAAACGCAAGGAATTACGGTATC

236

209-231

[29,30]

SScps2J-R

CATTTCCTAAGTCTCGCACC

445-426


tet(L)Ng-F

TCGTTAGCGTGCTGTCATTC

698

680-700

[31]

tet(L)-R-pDG364

CTTAGAAATCCCTTTGAGAAT

1378-1358

This study


tet(W)- F

TTGGAATTCTTGCCCATGTAGACGC

1872

18-42

This study

tet(W)- R

TTGTCCAGGCGGTTGTTTGGAC

1889-1868

tet(W)-F-HN

GGTGCAGTTGGAGGTTGTTT

410

1179-1198

tet(W)-R-HN

CCTTCAATGCCTGTTCCAAT

1569-1588

tet(O)-F-pDG364

ATGAAAATAATTAACTTAGG

1920

1-19

tet(O)-R-pDG364

TTAAGCTAACTTGTGGAACA

1920-1901

ss-tet(M)-whole-F

ACAGACAAAGAACTATCCTTAATG

2500

419-396

ss-tet(M)-whole-R

GTACCCAGTTTAAGAATACCTTTATC

161-136


Additional primers used for sequencing


tet(O)-2-F

TTCAAGACGCCTCCCTGTTC

679-698

This study

tet(O)-2-R

ATTTGGCGGGACTTCTATGTGG

1318-1296

ss-tet(M)-Fseq1

GTTAAATCACTACGATAT

1763-1745

ss-tet(M)-Rseq1

ATAGTGTTCTTGGAGATA

906-929

ss-tet(M)-Fseq2

GTATAATTTCATGTGTCG

1162-1144

ss-tet(M)-Rseq2

AGATGGCGTACAAGCACA

305-323

ss-PAI-P8-tet(M)-R

GCCCTTTTGGGTTTTTGAAT

-33- -14

ss-PAItetM-P9over F

GGGAATCCCCATTTTCCTAA

366-347


*: These primers were named mef(A/E) in the referenced publication.

Hoa et al. BMC Infectious Diseases 2011 11:6   doi:10.1186/1471-2334-11-6

Open Data