Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Increased telomere length and proliferative potential in peripheral blood mononuclear cells of adults of different ages stimulated with concanavalin A

BMC Geriatrics volume 13, Article number: 99 (2013) Cite this article

Abstract

Background

Recently, a direct correlation with telomere length, proliferative potential and telomerase activity has been found in the process of aging in peripheral blood cells. The objective of the study was to evaluate telomere length and proliferative potential in peripheral blood mononuclear cells (PBMCs) after stimulation with Concanavalin A (ConA) of young adults compared with older adults.

Methods

Blood samples were obtained from 20 healthy young males (20–25 years old) (group Y) and 20 males (60–65 years old) (group O). We compared PBMC proliferation before and after stimulation with ConA. DNA was isolated from cells separated before and after culture with ConA for telomeric measurement by real-time polymerase chain reaction.

Results

In vitro stimulation of PBMCs from young subjects induced an increase of telomere length as well as a higher replicative capacity of cell proliferation. Samples from older adults showed higher loss of telomeric DNA (p = 0.03) and higher levels of senescent (≤6.2 kb) telomeric DNA (p = 0.02) and displayed a marked decrease of proliferation capacity. Viability cell counts and CFSE tracking in 72-h-old cell cultures indicated that group O PBMCs (CD8+ and CD4+ T cells) underwent fewer mitotic cycles and had shorter telomeres than group Y (p = 0.04).

Conclusions

Our findings confirm that telomere length in older-age adults is shorter than in younger subjects. After stimulation with ConA, cells are not restored to the previous telomere length and undergo replicative senescence. This is in sharp contrast to the response observed in young adults after ConA stimulation where cells increase in telomere length and replicative capacity. The mechanisms involved in this phenomenon are not yet clear and merit further investigation.

Peer Review reports

Background

Aging is associated with deterioration of physical and mental functions as well as increased morbidity and mortality. Its mechanism is not fully understood but a number of factors are involved such as hormonal imbalances, oxidative stress, metabolic changes, etc. At the cellular level, evidence suggest that aging is associated with lower immune reactivity and decreased numbers of circulating CD4+ T and B lymphocyte subsets [1]. Recently, a direct correlation with telomere length and telomerase activity has been found in the process of aging.

Telomeres are structures located at the extreme ends of chromosomes and are considered indicators of biological age. Early studies showed the essential role of telomeres in the protection of chromosome integrity [2]. These nucleoprotein caps are maintained by the enzyme tel-omerase [3, 4]. The importance of adequate telomerase activity and maintenance of telomere length for replicative potential and aging was initially inferred from studies in primary human fibroblast [5, 6]. In culture assays, division of fibroblasts resulted in progressive telomere attrition, culminating in a state of proliferative arrest or cellular senescence after a finite number of cell divisions, a phenomenon known as the Hayflick limit [7]. Excessive telomere shortening prior to the expression of telomerase can lead to chromosome fusion, which has been proposed as a mechanism for chromosome instability [8]. Maser et al. reported the contrasting contributions of telomeres in the initiation and suppression of cancer and reviewed the evidence that radical chromosomal aberrations typify cancer genomes [9].

On the other hand, the stimulation of expression of TERT (the catalytic subunit of telomerase) in cultured human fibroblast stabilized telomere length and endowed the cells with unlimited replicative potential without creating malignant properties [10]. Thus, cellular aging triggered by critical telomere shortening can be prevented or delayed by telomerase reactivation [11]. Induction of telomerase activity that allows indefinite cell proliferation has been documented in different human cells [12]. These crucial in vitro studies and others using telomerase knockout mice have been used to investigate telomere dynamics in the processes of aging and in several degenerative diseases in humans. Telomere shortening depends on cell division [13]. Therefore, telomere length not only provides information as an indicator of the replicative history of cells but may also suggest the replicative potential remaining in each cell [14].

Mondello et al. analyzed the length of the terminal restriction fragments (TRF) in fibroblast and blood cells from four healthy subjects >100 years old as well as 11 individuals of different ages. No correlation between mean TRF length and donor age was found. However, as expected, telomere shortening was detected during in vitro propagation of fibroblasts from aged subjects, suggesting that telomeres can be far from reaching a critical length [15].

Allsopp et al. examined the rate of telomere shortening in quiescent cells in vivo and measured TRF length in brain tissue from adult donors 32–75 years of age. No significant association was observed between TRF length and donor age (p = 0.087) in contrast to telomere length shortening that occurs during in vivo aging of mitotically active cells (p = 0.0001). These observations show that telomere shortening is largely, if not entirely, dependent on cell division and support the end replication problem as a mechanism of this process. Therefore, telomere length can be used as a biomarker for replicative capacity [16].

The purpose of our study was to evaluate telomere length and proliferative potential of peripheral blood mononuclear cells (PBMCs) of young adults compared with older adults. We compared PBMC proliferation before and after stimulation with ConA.

Methods

Blood samples were obtained from 20 healthy males (20–25 years old) (group Y/young), and 20 males (60–65 years old) (group O/older). All persons included in this study were nonsmokers with no history of alcohol abuse or drug consumption. This protocol was approved by the local Bioethics Committee of the Unidad Médica de Alta Especialidad (UMAE) No. 1 Bajío, Instituto Mexicano del Seguro Social (IMSS), León, Guanajuato, México. Written informed consent was obtained from each volunteer.

PBMC isolation and culture

PBMCs were isolated by Ficoll-Hypaque density gradient centrifugation (Sigma-Aldrich, St. Louis, MO). PBMCs were labeled with cell tracker dye CFSE (0.5 μM; Molecular Probes, Eugene, OR) to monitor proliferation. Briefly, PBMCs were suspended in PBS at a concentration of 1 × 106/ml, and an equal volume of 1 μM CFSE in PBS was added. PBMCs were incubated in the dark at room temperature for 10 min, centrifuged, and the supernatant discarded. Cells were resuspended in 5 ml of RPMI media and incubated for 30 min at 37°C with 5% CO2. CFSE-labeled PBMCs were then cultured with or without 2.5 μg/mL of concanavalin A (ConA, Sigma Aldrich) for 72 h at 37°C, 100% humidity and 5% CO2. After that, the percentage of divided cells was determined by flow cytometry analysis with a FACSCalibur™ flow cytometer (Becton-Dickinson, San Jose, CA) by using the Cell Quest software (Becton Dickinson).

Telomeric measurement

DNA was isolated from PBMCs before and after culture with ConA through phenol–chloroform technique for telomeric measurement. Telomeric length was measured as previously described [17] by PCR amplification with oligonucleotide primers designed to hybridize to the TTAGGG and CCCTAA repeats. The final concentrations of reagents in the PCR were 0.2 SYBR Green I (Molecular Probes), 15 mM Tris–HCl, pH 8.0, 50 mM KCl, 2 mM MgCl2, 0.2 mM each dNTP, 5 mM DTT, 1% DMSO and 1.25 U AmpliTaq Gold DNA polymerase. The final telomere primer concentrations were as follows: tel 1, 270 nM; tel 2, 900 nM. The final 36B4 (single copy gene) primer concentrations were 36B4u, 300 nM; 36B4d, 500 nM. Primer sequences (5′→3′) were as follows: tel 1, GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT; tel 2,TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA; 36B4u, CAGCAAGTGGGAAGGTGTAATCC; 36B4d,CCCATTCTATCATCAACGGGTACAA. [15]. All PCRs were performed using LightCycler® (model 1.5) by Roche thermocycler. The thermal cycling profile for both amplicons began with 95°C incubation for 3 min to activate the AmpliTaq Gold DNA polymerase. For telomere PCR, 40 cycles of 95°C for 15 s, 54°C for 2 min, and for 36B4 PCR, 40 cycles of 95°C for 15 s, 58°C for 1 min were set. LightCycler® (model 1.5) by Roche thermocycler was then used to generate the standard curve for each run and to determine the dilution factors of standards corresponding to the T and S amounts in each sample.

Statistical analysis

To determine between-group differences, we used Mann–Whitney U test. All data are presented as mean ± SE; p < 0.05 was accepted for statistical significance.

Results

Telomeric length in PBMCs before and after stimulation with ConA

We measured telomeric length in PBMCs before and after in vitro stimulation by RT-PCR technique. Unstimulated cells from group O had shorter telomeres than cells from group Y (p = 0.03). Consequently, cells from older adults (group O) did not show any changes of telomeric DNA (p = 0.17) and higher levels of senescent (≤6.3 kb) telomeric DNA (p = 0.02) (Table 1).

Table 1 Telomeric length before and after stimulation in both groups
Full size table

Surprisingly, we found increased telomere length in cells from Group Y after in vitro stimulation with ConA. Whereas no changes in telomeric length were observed in cells from group O with ConA stimulation (Table 1), cells from group Y are capable of increasing telomere length and, therefore, decreasing the percentage of critically short telomeres.

In both groups (young men and older men), the percentages of CD3+ as well as CD3- cells were similar. However, in group O the CD4+ subset was significantly higher than in group Y, whereas CD8+ population was slightly higher in group Y (data not shown).

PBMC proliferation and replicative potential

The capacity of PBMC proliferation after in vitro stimulation with ConA was significantly different between groups Y and O. In most cases, more cells from group Y reached more divisions than those in group O (Table 1). Therefore, CFSE-labeled cells from group O undergo fewer cell divisions (Figure 1) and had shorter telomeres than group Y (p=0.04) after 72 h of in vitro stimulation (Table 1). Coincidentally, cells with a low proliferative response to ConA stimulation (group O) were those with shorter telomeres.

Figure 1
figure 1

CFSE proliferation histograms (group Y and group O). Lymphocyte proliferation with concanavalin A stimulation was significantly different between groups. Number of reached divisions: 1) without divisions, 2) one division, 3) two divisions, and 4) three divisions. Significant difference is shown between groups* (calculated with Mann–Whitney U test). All data are presented as mean ± SE; p<0.05 was considered significant.

Full size image

Discussion

Our findings clearly point to the difference in telomere length and replicative response after ConA stimulation between PBMCs of young subjects and older subjects.

Shortening of telomeres is the cause of replicative senescence of mammalian cells in culture and may be a cause of cellular aging in vivo[18]. It has been shown that in some tissues cells suffer telomere shortening during aging in humans [4, 19–21].

It is important to note that telomere shortening in aging subjects has been reported in human peripheral blood leukocytes [22, 23], in PBMCs [24], and in T cells [25, 26]. The significance of this phenomenon is unclear, but it has been suggested that it is related to the diminished immunity that occurs in older age.

Yang et al. investigated the relationship between telomere biology and replicative senescence by measuring replicative capacity and telomere length as a function of donor age in cells from adrenal tissue from donors of different ages. They found an age-related decline in total replicative capacity. These authors confirm the relationship between telomere length, telomerase, and replicative capacity in culture [27]. However, Allsop et al. did not find any relation between TRF length and donor age [5].

Blackburn concluded that telomere length does not act as a mitotic clock and that the presence or absence of telomerase is crucial in maintaining cellular reproductive capacity. The author developed a dynamic two-state model of telomeres in which there was a switch between capped and uncapped states [28]. Enzymatically active telomerase apparently has a protective effect on very short telomeres that, in its absence, would have caused a cessation in cell division [28, 29]. Greider [30], a co-discoverer with Blackburn of telomerase, concluded that there is little or no evidence that the changes that cells in culture undergo are the same as those that normal cells undergo with age in vivo[31].

This concept assumed an iconic character with the report that ectopic expression of telomerase by a vector greatly extended the lifespan of human cells. That something similar might occur in vivo seemed consistent with initial reports that most human somatic tissues lack telomerase activity [31].

Loss of genome integrity and associated DNA damage signaling and cellular checkpoint responses are well-established intrinsic instigators that drive tissue degeneration during aging [32]. Mounting evidence in humans has also provided a strong association of limiting telomeres with increased risk of age-associated disease [33] and with onset of tissue atrophy and organ system failure in degenerative diseases. Controversially, Bestilny et al. reported an inverse relationship between telomere length and progression of immunosuppression, with HIV infection resulting in a 5-fold or greater acceleration of aging of the circulating PBMC component of the immune system [34]. Honda et al. also found that T cells showed an accelerated loss of telomeric DNA in patients with systemic lupus erythematosus [35].

We report here that unstimulated PBMCs from group O have shorter telomeres than group Y. Surprisingly, a 5-kb increase in telomeric length was found in PBMCs from group Y after in vitro stimulation with ConA. A previous study showed that restoration of telomerase activity prevented the wide range of degenerative pathologies [36].

Son et al. [37] observed that the capacity for induced telomerase expression in T and B cells is diminished with age. The replicative capacity in young T cells is considerably higher. This is influenced by the size of the telomere because we were able to compare between groups. The relationship between telomere length and replicative capacity before and after ConA stimulation is significantly different between groups. In most cases, more PBMCs reached more divisions in group Y than in group O. Jaskelioff et al. recently demonstrated that multiple aging phenotypes in a mouse model of accelerated telomere loss can be reversed within 4 weeks of reactivating telomerase. The authors speculate that some tissue stem/progenitor cells are retained in a quiescent and intact state, yet they can be enlisted to resume normal repopulating function upon elimination of genotoxic stress of telomeres [12]. Cumulative evidence implicating telomere damage as a driver of age-associated organ decline and disease risk [10, 38] and the dramatic reversal of systemic degenerative phenotypes in adult mice observed here support the development of regenerative strategies designed to restore telomere integrity.

Conclusions

Our findings demonstrate that elongation of telomeres is associated with a higher replicative capacity after stimulation with ConA in young adults. We can only speculate that this phenomenon may have been due to activation of telomerase through series of signaling pathways triggered by ConA. We are not aware that the mechanism of telomere elongation as a consequence of replicative stimulation has yet been studied. However, it may be a promising line of research. It is clear that in cells from older subjects this yet unknown mechanism is impaired.

References

  1. Sansoni P, Cossarizza A, Brianti V, Fagnoni F, Snelli G, Monti D, Marcato A, Passeri G, Ortolani C, Forti E, et al: Lymphocyte subsets and natural killer cell activity in healthy old people and centenarians. Blood. 1993, 82 (9): 2767-2773.

    CAS  PubMed  Google Scholar 

  2. McClintock B: The behavior in successive nuclear divisions of a chromosome broken at meiosis. Proc Natl Acad Sci USA. 1939, 25 (8): 405-416. 10.1073/pnas.25.8.405.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Blackburn EH: Switching and signaling at the telomere. Cell. 2001, 106 (6): 661-673. 10.1016/S0092-8674(01)00492-5.

    Article  CAS  PubMed  Google Scholar 

  4. Flores I, Cayuela ML, Blasco MA: Effects of telomerase and telomere length on epidermal stem cell behavior. Science. 2005, 309 (5738): 1253-1256. 10.1126/science.1115025.

    Article  CAS  PubMed  Google Scholar 

  5. Allsopp RC, Vaziri H, Patterson C, Goldstein S, Younglai EV, Futcher AB, Greider CW, Harley CB: Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci USA. 1992, 89 (21): 10114-10118. 10.1073/pnas.89.21.10114.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Tchirkov A, Lansdorp PM: Role of oxidative stress in telomere shortening in cultured fibroblasts from normal individuals and patients with ataxia-telangiectasia. Hum Mol Genet. 2003, 12 (3): 227-232. 10.1093/hmg/ddg023.

    Article  CAS  PubMed  Google Scholar 

  7. Hayflick L, Moorhead PS: The serial cultivation of human diploid cell strains. Exp Cell Res. 1961, 25: 585-621. 10.1016/0014-4827(61)90192-6.

    Article  CAS  PubMed  Google Scholar 

  8. Murnane JP: Telomere loss as a mechanism for chromosome instability in human cancer. Cancer Res. 2010, 70 (11): 4255-4259. 10.1158/0008-5472.CAN-09-4357.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Maser RS, DePinho RA: Connecting chromosomes, crisis, and cancer. Science. 2002, 297 (5581): 565-569. 10.1126/science.297.5581.565.

    Article  CAS  PubMed  Google Scholar 

  10. Sahin E, Depinho RA: Linking functional decline of telomeres, mitochondria and stem cells during ageing. Nature. 2010, 464 (7288): 520-528. 10.1038/nature08982.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Bernardes de Jesus B, Blasco MA: Aging by telomere loss can be reversed. Cell Stem Cell. 2011, 8 (1): 3-4. 10.1016/j.stem.2010.12.013.

    Article  CAS  PubMed  Google Scholar 

  12. Jaskelioff M, Muller FL, Paik JH, Thomas E, Jiang S, Adams AC, Sahin E, Kost-Alimova M, Protopopov A, Cadinanos J, et al: Telomerase reactivation reverses tissue degeneration in aged telomerase-deficient mice. Nature. 2011, 469 (7328): 102-106. 10.1038/nature09603.

    Article  CAS  PubMed  Google Scholar 

  13. Counter CM, Hahn WC, Wei W, Caddle SD, Beijersbergen RL, Lansdorp PM, Sedivy JM, Weinberg RA: Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc Natl Acad Sci USA. 1998, 95 (25): 14723-14728. 10.1073/pnas.95.25.14723.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Akiyama M, Hoshi Y, Sakurai S, Yamada H, Yamada O, Mizoguchi H: Changes of telomere length in children after hematopoietic stem cell transplantation. Bone Marrow Transpl. 1998, 21 (2): 167-171. 10.1038/sj.bmt.1701060.

    Article  CAS  Google Scholar 

  15. Mondello C, Petropoulou C, Monti D, Gonos ES, Franceschi C, Nuzzo F: Telomere length in fibroblasts and blood cells from healthy centenarians. Exp Cell Res. 1999, 248 (1): 234-242. 10.1006/excr.1999.4398.

    Article  CAS  PubMed  Google Scholar 

  16. Allsopp RC, Chang E, Kashefi-Aazam M, Rogaev EI, Piatyszek MA, Shay JW, Harley CB: Telomere shortening is associated with cell division in vitro and in vivo. Exp Cell Res. 1995, 220 (1): 194-200. 10.1006/excr.1995.1306.

    Article  CAS  PubMed  Google Scholar 

  17. Cawthon RM: Telomere measurement by quantitative PCR. Nucleic Acids Res. 2002, 30 (10): e47-10.1093/nar/30.10.e47.

    Article  PubMed  PubMed Central  Google Scholar 

  18. Simon NM, Smoller JW, McNamara KL, Maser RS, Zalta AK, Pollack MH, Nierenberg AA, Fava M, Wong KK: Telomere shortening and mood disorders: preliminary support for a chronic stress model of accelerated aging. Biol Psychiatry. 2006, 60 (5): 432-435. 10.1016/j.biopsych.2006.02.004.

    Article  CAS  PubMed  Google Scholar 

  19. Flores I, Canela A, Vera E, Tejera A, Cotsarelis G, Blasco MA: The longest telomeres: a general signature of adult stem cell compartments. Genes Dev. 2008, 22 (5): 654-667. 10.1101/gad.451008.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Armanios M, Alder JK, Parry EM, Karim B, Strong MA, Greider CW: Short telomeres are sufficient to cause the degenerative defects associated with aging. Am J Hum Genet. 2009, 85 (6): 823-832. 10.1016/j.ajhg.2009.10.028.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Epel ES, Lin J, Wilhelm FH, Wolkowitz OM, Cawthon R, Adler NE, Dolbier C, Mendes WB, Blackburn EH: Cell aging in relation to stress arousal and cardiovascular disease risk factors. Psychoneuroendocrino. 2006, 31 (3): 277-287. 10.1016/j.psyneuen.2005.08.011.

    Article  CAS  Google Scholar 

  22. Slagboom PE, Droog S, Boomsma DI: Genetic determination of telomere size in humans: a twin study of three age groups. Am J Hum Genet. 1994, 55 (5): 876-882.

    CAS  PubMed  PubMed Central  Google Scholar 

  23. Frenck RW, Blackburn EH, Shannon KM: The rate of telomere sequence loss in human leukocytes varies with age. Proc Natl Acad Sci U S A. 1998, 95 (10): 5607-5610. 10.1073/pnas.95.10.5607.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Iwama H, Ohyashiki K, Ohyashiki JH, Hayashi S, Yahata N, Ando K, Toyama K, Hoshika A, Takasaki M, Mori M, et al: Telomeric length and telomerase activity vary with age in peripheral blood cells obtained from normal individuals. Hum Genet. 1998, 102 (4): 397-402. 10.1007/s004390050711.

    Article  CAS  PubMed  Google Scholar 

  25. Weng NP, Levine BL, June CH, Hodes RJ: Human naive and memory T lymphocytes differ in telomeric length and replicative potential. Proc Natl Acad Sci U S A. 1995, 92 (24): 11091-11094. 10.1073/pnas.92.24.11091.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Rufer N, Brummendorf TH, Kolvraa S, Bischoff C, Christensen K, Wadsworth L, Schulzer M, Lansdorp PM: Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood. J Exp Med. 1999, 190 (2): 157-167. 10.1084/jem.190.2.157.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Yang L, Suwa T, Wright WE, Shay JW, Hornsby PJ: Telomere shortening and decline in replicative potential as a function of donor age in human adrenocortical cells. Mech Ageing Dev. 2001, 122 (15): 1685-1694. 10.1016/S0047-6374(01)00280-9.

    Article  CAS  PubMed  Google Scholar 

  28. Blackburn EH: Telomere states and cell fates. Nature. 2000, 408 (6808): 53-56. 10.1038/35040500.

    Article  CAS  PubMed  Google Scholar 

  29. Ouellette MM, Liao M, Herbert BS, Johnson M, Holt SE, Liss HS, Shay JW, Wright WE: Subsenescent telomere lengths in fibroblasts immortalized by limiting amounts of telomerase. J Biol Chem. 2000, 275 (14): 10072-10076. 10.1074/jbc.275.14.10072.

    Article  CAS  PubMed  Google Scholar 

  30. Greider CW: Cellular responses to telomere shortening: cellular senescence as a tumor suppressor mechanism. Harvey Lect. 2000, 96: 33-50.

    PubMed  Google Scholar 

  31. Rubin H: The disparity between human cell senescence in vitro and lifelong replication in vivo. Nat Biotechnol. 2002, 20 (7): 675-681. 10.1038/nbt0702-675.

    Article  CAS  PubMed  Google Scholar 

  32. Hoeijmakers JH: DNA damage, aging, and cancer. N Engl J Med. 2009, 361 (15): 1475-1485. 10.1056/NEJMra0804615.

    Article  CAS  PubMed  Google Scholar 

  33. Cawthon RM, Smith KR, O’Brien E, Sivatchenko A, Kerber RA: Association between telomere length in blood and mortality in people aged 60 years or older. Lancet. 2003, 361 (9355): 393-395. 10.1016/S0140-6736(03)12384-7.

    Article  CAS  PubMed  Google Scholar 

  34. Bestilny LJ, Gill MJ, Mody CH, Riabowol KT: Accelerated replicative senescence of the peripheral immune system induced by HIV infection. Aids. 2000, 14 (7): 771-780. 10.1097/00002030-200005050-00002.

    Article  CAS  PubMed  Google Scholar 

  35. Honda M, Mengesha E, Albano S, Nichols WS, Wallace DJ, Metzger A, Klinenberg JR, Linker-Israeli M: Telomere shortening and decreased replicative potential, contrasted by continued proliferation of telomerase-positive CD8+CD28(lo) T cells in patients with systemic lupus erythematosus. Clin Immunol. 2001, 99 (2): 211-221. 10.1006/clim.2001.5023.

    Article  CAS  PubMed  Google Scholar 

  36. Samper E, Flores JM, Blasco MA: Restoration of telomerase activity rescues chromosomal instability and premature aging in Terc-/- mice with short telomeres. EMBO Rep. 2001, 2 (9): 800-807. 10.1093/embo-reports/kve174.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Son NH, Murray S, Yanovski J, Hodes RJ, Weng N: Lineage-specific telomere shortening and unaltered capacity for telomerase expression in human T and B lymphocytes with age. J Immunol. 2000, 165 (3): 1191-1196.

    Article  CAS  PubMed  Google Scholar 

  38. Sharpless NE, DePinho RA: How stem cells age and why this makes us grow old. Nat Rev Mol Cell Biol. 2007, 8 (9): 703-713. 10.1038/nrm2241.

    Article  CAS  PubMed  Google Scholar 

Pre-publication history

Download references

Acknowledgements

This work was supported by a grant from the Mexican Council of Science and Technology (CONCITEG) and by the Medical Research Council of the Mexican Social Security Institute (IMSS), Mexico.

English editorial support was provided by Sharon Morey, Executive Editor, International Editing Group.

Author information

Authors and Affiliations

  1. Unidad de Investigación en Epidemiología Clínica, Unidad Médica de Alta Especialidad (UMAE), No. 1 Bajío, Instituto Mexicano del Seguro Social (IMSS), León, Guanajuato, Mexico

    Blanca Murillo-Ortiz, Froylán Albarrán-Tamayo & Sandra Martínez-Garza

  2. Departamento de Investigaciones Médicas, Universidad de Guanajuato, León, Guanajuato, Mexico

    Sergio López-Briones

  3. Unidad de Investigación Médica en Enfermedades Oncológicas, CMN, SXXI, IMSS, México, DF, Mexico

    Luis Benítez-Bribiesca

  4. Unidad de Investigación en Genética Humana, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, IMSS, México, DF, Mexico

    Diego Arenas-Aranda

Authors
  1. Blanca Murillo-Ortiz
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Froylán Albarrán-Tamayo
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Sergio López-Briones
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Sandra Martínez-Garza
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Luis Benítez-Bribiesca
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Diego Arenas-Aranda
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Blanca Murillo-Ortiz.

Additional information

Competing interests

The authors declare that there are no conflicts of interest in the elaboration of this investigation.

Authors’ contributions

BM conceived the study, carried out the molecular genetic studies and participated in its design and coordination and helped to draft the manuscript. FA carried out the molecular genetic studies. SL carried out the flow cytometer and helped to draft the manuscript. SM carried out the molecular genetic studies. LB participated in the design and coordination and helped to draft the manuscript. DA participated in the sequence alignment. All authors read and approved the final manuscript.

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Murillo-Ortiz, B., Albarrán-Tamayo, F., López-Briones, S. et al. Increased telomere length and proliferative potential in peripheral blood mononuclear cells of adults of different ages stimulated with concanavalin A. BMC Geriatr 13, 99 (2013). https://doi.org/10.1186/1471-2318-13-99

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/1471-2318-13-99

Keywords

BMC Geriatrics

ISSN: 1471-2318

Contact us