Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Role of the ABCG8 19H risk allele in cholesterol absorption and gallstone disease

BMC Gastroenterology volume 13, Article number: 30 (2013) Cite this article

Abstract

Background

Gallstone disease is associated with p.D19H of ABCG8 as well as alterations of cholesterol and bile acid metabolism. However, molecular mechanisms have not been fully elucidated. It is important to understand the link between the sterol transporters ABCG5/8 and NPC1L1 and intestinal cholesterol absorption as well as de novo synthesis in gallstone patients stratified according to 19H risk allele. Moreover, the functional importance of the 19H variant on intestinal ABCG8 feature remains to be clarified.

Methods

Measurements of serum surrogate markers of cholesterol absorption (plant sterols: sitosterol, campesterol) and synthesis (cholesterol precursor: lathosterol) were carried out by gas chromatography/mass spectrometry (GC/MS). For expression studies, total RNA was isolated from 168 ileal biopsies of study participants with (34) and without gallstone disease (134). Messenger RNA was measured by LightCycler real-time PCR. Genomic DNA was obtained from blood leukocytes. Genotype frequencies of p.D19H were established using MALDI-TOF mass spectrometry.

Results

Compared to controls, cholesterol absorption but not synthesis in gallstone carriers was diminished by about 21% based on low serum sitosterol (P = 0.0269) and campesterol (P = 0.0231) to cholesterol ratios. D19H was found to be significantly associated with gallstones (odds ratio [OR] = 2.9, P = 0.0220, 95% confidence interval [CI]:1.22-6.89), particularly in the overweight cohort (OR = 3.2, P = 0.0430, 95% CI:1.07-9.26). Cholesterol absorption was about 24% lower in individuals carrying p.D19H compared to wild type (P sitosterol = 0.0080, P campesterol = 0.0206). Moreover, irrespective of phenotype, carriers of p.D19H displayed a significant lower absorption than carriers of the major allele. The most pronounced effect on cholesterol absorption ratio was observed for serum campesterol levels (wild type controls to mutated controls 28%, P = 0.0347 and wild type controls to gallstone carriers with 19H allele 37%, P = 0.0030). Notably, ABCG5/8 and NPC1L1 expression was similar in gallstone carriers and controls regardless of p.D19H presence.

Conclusions

Both gallstone disease and p.D19H of ABCG8 are associated with diminished cholesterol absorption. However, p.D19H is not responsible for the differences in small intestinal sterol transporter expression.

Peer Review reports

Background

Gallstone disease is a frequent health problem affecting 10-20% of the Western population [1]. An imbalance between cholesterol, bile acids and phospholipids is a key factor for cholesterol gallstone formation [2] but the metabolic cause of this disturbance is still unclear. Gallstone carriers and controls exhibit basic differences in cholesterol and bile acid homeostasis [3, 4]. In the presence of normal dietary cholesterol its absorption tended to be diminished in gallstone carriers whereas synthesis was induced [3]. However, the contribution of newly synthesized to biliary cholesterol in animals and man is small [5–8] and the origin of excess biliary cholesterol remains uncertain. Moreover, gallstone carriers respond to an increased cholesterol load with an elevated biliary cholesterol secretion and exhibit a diminished hepatic de novo cholesterol synthesis [3]. Furthermore, the regulation of cholesterol synthesis in overweight persons, prone to develop gallstones, differs from the lean individuals and is feedback inhibited after the application of long-term high cholesterol diet [9]. Gallstone carriers also exhibit a reduction in the primary bile acid pool size, an increase of the biliary fraction of secondary bile acids, reduced gallbladder motility as well as a prolonged intestinal transit time [10, 11]. The mechanism behind the low primary bile acids in bile may be a diminished expression of bile acid transporters in the terminal ileum [12, 13]. The ultimate consequence is cholesterol supersaturation in the gallbladder bile, leading to crystal precipitation of free cholesterol and gallstone formation [2, 3, 10, 14].

Responsible for cholesterol transport in the human gut are the heterodimeric ATP-binding cassette transporter (ABCG5/8) and Niemann-PickC1-Like 1 Protein (NPC1L1). Following incorporation into micelles, dietary as well as biliary cholesterol is available for uptake from the intestinal lumen through the importer NPC1L1 [15]. This protein is localized at the apical membrane of the enterocytes [16] and contributes to intestinal cholesterol homeostasis [15–18]. The heterodimeric sterol transporter ABCG5/8 determines hepatobiliary cholesterol secretion and cholesterol efflux out of the enterocytes back into the intestinal lumen, thereby promoting net cholesterol removal from the body [19–21]. Moreover, the intestinal cholesterol transporters are under the transcriptional control of liver X receptors (LRXα/β), sterol regulatory element-binding protein (SREBP2), hepatocyte nuclear factors (HNF1α/4α) and peroxisome proliferator-activated receptor (PPARδ) [18, 22–25].

Human and murine studies support a strong genetic background of gallstone risk [26–28]. Most prominently associated with gallstone disease is the D19H polymorphism of the ABCG8 gene [29]. In healthy individuals, the D19H polymorphism was associated with low cholesterol absorption [30]. Similarly, Gylling described low serum total cholesterol and cholesterol absorption in the cohort of mildly to moderately hypercholesterolemic subjects with the 19H allele [31]. Recently, the study of Krawczyk showed that cholesterol absorption was significantly lower and de novo synthesis higher in gallstone carriers [4] but this was independent of the D19H polymorphism.

The present study therefore addressed the following questions: i) are both, low cholesterol absorption and increased de novo cholesterol synthesis indeed common in gallstone carriers, ii) is the expression of intestinal cholesterol transporters and their transcription factors different in gallstone carriers, iii) does the D19H polymorphism of the ABCG8 gene affect any of these parameters?

Methods

Ethics statement

The local ethics committee (ethics committee of the University Hospital of Tuebingen and University Tuebingen) approved this study and all subjects gave written informed consent prior to participation.

Subjects

Study subjects were recruited from the contingent of individuals invited to undergo routine colonoscopy according to the recommendations of German Health Organisation and for cancer prevention. Individuals, who agreed the participation in the study, were personally interviewed and seen by the physicians regarding their health conditions. Subjects included in this study had a) normal serum lipid values and no history of taking lipid-lowering drugs or drugs interfering with bile acid uptake, b) no known medical conditions affecting lipid metabolism, c) normal liver function and no signs of haemolysis or other conditions associated with pigment stones, d) no intestinal surgery and e) no impaired nutritional status. None of the gallstone carriers or controls had symptomatic gallstone disease, abnormal liver function, elevated serum lipids or inflammation in the ileum. Biopsies and blood samples were collected from a total of 168 individuals in the Robert Bosch Hospital in Stuttgart. Blood samples (3–5 mL) were used for cholesterol and phytosterol measurements as well as for genotyping investigations. Up to eight ileal biopsy specimens were taken from each participant (for this investigation two separate samples, each about 8–10 mg, were used). 134 subjects were healthy controls and 34 individuals had gallstones. The presence or absence of gallstones was confirmed by ultrasound. Serum triglycerides and cholesterol levels were analysed by standard clinical tests.

Measurements of sterol synthesis and absorption

Measurements of the non-cholesterol sterols lathosterol, campesterol and sitosterol from serum samples were carried out by GC-MS as reported previously [32]. Cholesterol absorption was given as ratio of sitosterol or campesterol to total cholesterol and cholesterol synthesis was calculated as the ratio of lathosterol to cholesterol [33].

Real-time quantitative reverse transcription – polymerase chain reaction (RT-PCR)

Total RNA was isolated from whole biopsy specimen using TRIzol extraction procedure (Invitrogen) according to the manufacturer’s protocol. The integrity, quality and quantity of RNA were analysed by gel electrophoresis and absorption measurement. Four hundred ng of total RNA was reverse transcribed using the (AMV)-reverse transcriptase system (Promega) and random hexamers. RT-PCR was performed with LightCycler sequence detection system (Roche Diagnostics) as reported previously [12, 13]. Primer sequences used for amplification of human ABCG5, ABCG8, NPC1L1, LXRα, LXRβ, HNF1α, HNF4α, PPARδ and SREBP2 are listed in Table 1. Target specific PCR conditions were: 95°C for 5 min, 40 cycles at 95°C for 10 s, followed by 60°C for 5 s, then 72°C for 7 s. For the quantification of NPC1L1 a PCR of 50 cycles was necessary. At the end of the PCR, a dissociation curve was performed. The quantity for any given transcript was calculated using the second derivative maximum method according to manufacturer’s instructions. Gene-specific plasmids served as control templates with specific oligonucleotide primer pairs. All measurements were carried out in duplicate.

Table 1 Primer sequences used for QRT-PCR
Full size table

Plasmid construct

Plasmids were constructed with the TOPO TA Cloning Kit (Invitrogen) according to manufacturer’s recommendations. Four μL PCR product were subcloned into the EcoRI sites of a 2.1 TOPO TA cloning vector. Transformation was performed with two μl of the ligation onset to TOP 10 cells (E. coli) and spread to agar plates appended with X-Gal and ampicillin. The sample was incubated overnight at 37°C. White colonies were picked and purified/isolated with the Miniprep kit (Qiagen). The positive clones were verified by DNA sequencing.

Western blot analysis

For protein analysis a separate whole ileal mucosal biopsy was required. Total protein was isolated using TRIzol Reagent (Invitrogen). Protein concentration was determined applying the Bradford assay (Bio-Rad). Samples were heated at 95°C for 5 min. A total of six μg for ABCG8 and 15 μg for ABCG5/NPC1L1 protein were loaded and then electrophoresed (90 min, 100 V) on self-cast SDS-PAGE gels (ABCG5/8 10%, NPC1L1 8%) and blotted on nitrocellulose (0.45 μm, Whatman). After blotting, membranes were blocked for 1 h with 5% non-fat dry-milk (NFDM) in Tris-buffered saline containing 0.1% Tween 20 (TBST). Hereafter, membranes were incubated overnight with primary antibodies (ABGC5: ab45279/Abcam diluted 1:1,000 in 3% NFDM/TBST and 1% of Roti®-Block reagent (Roth); ABCG8: NB400-110/Novus Biologicals diluted 1:3,000 in 5% NFDM/TBST and NPC1L1:EPR5717/ab124801/Abcam diluted 1:200 in 3% NFDM/TBST). After being washed five times for 5 min blots were probed with the secondary antibody, peroxidise-conjugated goat anti-rabbit IgG (1:10,000, Dianova) and exposed to a chemiluminescent reagent (SuperSignalT West Dura; Pierce). The immunoreactive band was obtained at the predicted size of 75 kDa representing ABCG5 or ABCG8 and 145 kDa representing the NPC1L1 monomer. Bands were photographed and immunoquantitation was accomplished by densitometric analysis using the software AIDA (Raytest). To account for variability in the amounts of enterocytes in biopsy specimens, villin contents of all samples were determined. Therefore membranes were incubated with a primary antibody against human villin (1:2,000, Chemicon International), followed by incubation with the secondary peroxidise-conjugated anti-mouse IgG antibody (1:1,500, Oncogene). Protein staining was obtained at the predicted size of 95 kDa. All measurements were carried out in duplicate.

Isolation of DNA

Genomic DNA was extracted from peripheral blood leukocytes by standard methods using the Qiagen system (QIAamp DNA blood kit/QIAGEN DNA Blood Midi Prep) according to manufacturer’s recommendations.

Genotyping

The D19H SNP analysis of ABCG8 was performed with blood DNA using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) of allele specific primer extension products as reported previously [34], applying the following primer sequences:

1st-primer: ACGTTGGATGAGGAGAGAGGGCTGCCGAAA,

2nd-primer: ACGTTGGATGACTTCCCATTGCTCACTCAC and

extension primer: TGCTCACTCACCGAGGTATG.

For quality control no-template controls in all plates and repeated analysis of 10% of randomly selected samples were performed.

Statistics

For statistical analysis GraphPad Prism version 5 was used (GraphPad Software, San Diego, Ca, USA). Clinical characteristics of study participants and all data are presented as means ± standard error of the mean (SEM). Differences between groups (anthropometric and metabolic characteristics (age, body mass index (BMI), total cholesterol and total triglycerides), cholesterol absorption and synthesis ratios and all expression data) were investigated using the two-tailed Mann–Whitney U-test. All correlations (of expression values as well as of cholesterol absorption and synthesis ratios) between variables were analysed with Spearman’s correlation rank test. Observed and expected genotype frequencies within the study population were compared by means of Hardy–Weinberg equilibrium calculations [35]. Data were considered in Hardy–Weinberg equilibrium when P-values were >0.05. Statistical analysis of genotype frequency differences between gallstone carriers and controls was done using two-sided Fisher’s exact test as appropriate. Odds ratios (ORs) together with a 95% confidence interval (CI) are given as risk measures for the development of gallstones. All statistical tests were two-tailed and a P-value of <0.05 was considered as statistically significant.

Results

Characteristics of the study cohort

Several relevant anthropometric and metabolic characteristics (age, serum cholesterol and triglyceride levels) of the participants did not differ significantly and are summarized in Table 2. Therefore, the total study cohort was stratified in two weight groups. The calculation of anthropometric data reveal a mean age of 57 years in the control group and 61 years in the gallstone carrier group. As weight also depends on age [36–40], in the present study the normal weight group was defined as BMI ≤ 25.4, individuals with BMI > 25.4 were regarded as overweight. Since the percentage of overweight subjects was higher among gallstone carriers (68%) than among control individuals (44%), the mean body mass index was slightly higher in the gallstone group (BMI = 26.6) compared to controls (BMI = 25.2) (P = 0.0378).

Table 2 Anthropometric and metabolic characteristics of the Stuttgart study cohort
Full size table

Cholesterol absorption and synthesis in gallstone disease

Cholesterol absorption based on the serum sitosterol/cholesterol ratio correlated well with the campesterol/cholesterol ratio (ρ = 0.90, P < 0.0001, Spearman’s rank test). Interestingly, in the total cohort including both weight groups, cholesterol absorption was significantly lower by about 21% in gallstone carriers compared to controls (sitosterol P = 0.0269, campesterol P = 0.0231) (Table 2). The correlation between hepatic cholesterol synthesis and intestinal absorption was inverse and statistically significant (sitosterol/lathosterol ρ = −0.43, P < 0.0001; campesterol/lathosterol ρ = −0.38, P < 0.0001, Spearman’s rank test). In principle, these results were similar in female and male subpopulations when analysed separately, as shown in Additional file 1: Table S1C and D.

Overweight controls exhibited a higher synthesis (+33% P = 0.0028) and lower absorption (sitosterol −22% P = 0.0044; campesterol −26% P = 0.0065) rate than normal weight persons. Remarkably, in the subgroups the rate of cholesterol synthesis tended to be higher (4-22%, ns) and of cholesterol absorption lower (on average ~17%, ns) in gallstone individuals than in controls. However, none of these differences between gallstone carriers and controls were statistically significant.

Ileal expression of sterol transporters and their relevant transcription factors in gallstone disease

Next, the ileal expression patterns of the three relevant sterol transporters ABCG8, ABCG5 and NPC1L1 were analysed (Figure 1). Regarding sterol exporter ABCG8 and ABCG5, no significant changes in expression were apparent when stratified according to gallstones (Figure 1A and B), also not within the different weight groups. In comparison with the exporters detailed above, ileal expression of the NPC1L1 importer was rather low (Figure 1C). Only normal weight stone-carriers exhibited a reduced expression by 80% compared to respective controls (P = 0.0417), whereas all other groups showed no relevant and significant expression differences. As shown in Figure 1D, comparable expression patterns could be stated on protein levels. The correlation analyses by Spearman’s rank test between transporters showed the following moderate to small correlation coefficients: ABCG5/ABCG8 ρ = 0.50, P < 0.0001; ABCG5/NPC1L1 ρ = 0.44, P < 0.0001 and ABCG8/NPC1L1 ρ = 0.12, P = 0.1812.

Figure 1
figure 1

Expression of cholesterol transporters in female gallstone carriers and healthy controls. The expression analysis was performed in human ileal mucosal biopsies. Values are calculated as means ± SEM (standard error of the mean). Significance between the controls and gallstone carriers was analysed with Mann–Whitney U-test (nonparametric, two-tailed). Normal weight subgroup is defined as BMI ≤ 25.4, overweight subgroup as BMI > 25.4. P-values <0.05 were considered as statistically significant. (A-C) Quantification of mRNA expression is given as transcript numbers. ABCG5/ABCG8 = ATP-binding cassette transporter, NPC1L1 = Niemann-Pick C1-Like 1 protein *P = 0.0417, C = control subject, GS = gallstone carrier. Total: C = 98, GS = 30; normal weight: C = 57, GS = 10; overweight: C = 41, GS = 20. (D) Representative Western blot images of ABCG8, ABCG5 and NPC1L1 in ileal mucosa of gallstone carriers and controls. Protein content was determined by densitometric analysis. The data were normalized to villin, an epithelial marker protein. ABCG8: C = 70, GS = 20; ABCG5: C = 7, GS = 7; NPC1L1: C = 7, GS = 7.

Full size image

Furthermore, it was investigated whether gallstone disease is associated with alterations in the major regulatory transcription factors of the sterol transporters as summarized in Table 3. Only for HNF1α an increased transcript expression was observed in overweight gallstone carriers compared to relevant controls (P = 0.0470). None of the other regulatory factors exhibited any significant expression difference between controls and gallstone carriers in general, also not in the different weight groups. Finally, no clear expression correlation of the transcription factors to their respective transporters could be stated (data not shown).

Table 3 Mean values of mRNA transcript expression in ileal mucosa of important transcription factors in gallstone carriers and healthy controls
Full size table

Association of D19H polymorphism with cholelithiasis

Since individuals with the D19H polymorphism (rs11887534, c.52 G > c) in the ABCG8 gene are known to have a higher risk of developing gallstones [29, 41], a genotype analysis of this polymorphism was performed in our cohort. The study population was subdivided into weight- and disease-specific subgroups. Genotype frequencies, odds ratios (ORs) and 95% confidence intervals (CI) for each subgroup were calculated to obtain genotype-associated disease risk estimations (Table 4). Moreover, the genotype-associated disease risk was tested by analysing wild type homozygous (GG) individuals compared to the subjects with the heterozygous type (Gc). Confirming prior reports [29, 41], D19H was found to be significantly associated with gallstone disease in our total population with OR = 2.9 (P = 0.0220, 95% CI: 1.22–6.89). Notably, overweight simultaneous carriers of gallstones and p.D19H displayed a higher OR (OR = 3.2, P = 0.0430, 95% CI: 1.07–9.26) than the respective normal weight group (OR = 1.6, P = 0.6270, 95% CI: 0.30–8.77).

Table 4 The frequency of the polymorphism D19H in the gallstone carriers and controls of the population from Stuttgart
Full size table

Influence of the D19H polymorphism on cholesterol metabolism and intestinal ABCG8 expression

Next, we analysed the effect of the D19H polymorphism in ABCG8 on cholesterol absorption and cholesterol synthesis. As shown in Figure 2A and B, carriers of the D19H gallstone risk allele were characterised by significantly reduced intestinal cholesterol absorption of about 24% (sitosterol P = 0.0080, campesterol P = 0.0206).

Figure 2
figure 2

Influence of the polymorphism D19H on markers of cholesterol metabolism. Cholesterol absorption is calculated as the ratio of sitosterol or campesterol to cholesterol (A, B), cholesterol synthesis is calculated as the ratio of lathosterol to cholesterol (C). Values are calculated as means ± SEM. Significance between the wild type individuals and SNP carriers was analysed with Mann–Whitney U-test (nonparametric, two-tailed). P-values <0.05 were considered as statistically significant. (GG) = wild type individual; (Gc) = carrier of p.D19H; (GG) = 93 and (Gc) = 25. * P sitosterol = 0.0080, * P campesterol = 0.0206.

Full size image

After stratifying the Stuttgart population into phenotype- and genotype-specific groups, the influence of the 19H allele on sterol levels was investigated further (Figure 3). The level of cholesterol absorption markers was lower by 15–19% in gallstone carriers with the wild type allele than in the controls (Figure 3A and B). There was no relevant difference in absorption between gallstone carriers and controls with the minor allele. However, independent of gallstone status, cholesterol absorption was consistently lower in carriers of the Gc variant compared with wild type. The most pronounced effect on cholesterol absorption ratio was observed for serum campesterol levels (wild type controls to mutated controls 28%, P = 0.0347 and wild type controls to cases with p.D19H 37%, P = 0.0030). Regarding the cholesterol synthesis marker lathosterol and serum cholesterol levels, no significant differences were detected between the genotype/phenotype groups (Figure 3C and D).

Figure 3
figure 3

Influence of the polymorphism D19H on markers of cholesterol metabolism in gallstone disease. Cholesterol absorption is calculated as the ratio of sitosterol or campesterol to cholesterol (A, B), cholesterol synthesis is calculated as the ratio of lathosterol to cholesterol (C), total serum cholesterol levels mg/dL (D). Values are calculated as means ± SEM. Significance between wild type individuals and SNP carriers was analysed with Mann–Whitney U-test (nonparametric, two-tailed). P-values <0.05 were considered as statistically significant. C = control subject, GS = gallstone carrier. GG genotype (wild type individual): C = 75, GS = 14; Gc genotype (carrier of p.D19H): C = 18, GS = 11.

Full size image

To study whether this polymorphism affected intestinal transporter expression, the intestinal expression of the ABCG8 gene was related to the D19H subgroups. Ileal ABCG8 levels, mRNA as well as protein features, did not differ between controls with and without the SNP, also not in the gallstone group (Figure 4).

Figure 4
figure 4

Correlation of ABCG8 expression to the frequency of the polymorphism D19H in the Stuttgart cohort. The expression analysis was performed in human ileal mucosal biopsies. Values are given as means ± SEM. Significance between the subgroups was analysed with Mann–Whitney U-test (nonparametric, two-tailed). P-values <0.05 were considered as statistically significant. (A) Quantitative analysis of mRNA expression is calculated as copy numbers. (GG) = wild type individual; (Gc) = carrier of p.D19H. Controls: (GG) = 80 and (Gc) = 15; gallstone carriers: (GG) = 20 and (Gc) = 9. (B) Representative Western blot images of ABCG8 protein and villin in ileal mucosa of control individuals and gallstone carriers, with and without p.D19H. Protein content was determined by densitometric analysis. The data were normalized to villin, an epithelial marker protein. Controls: (GG) = 59 and (Gc) = 11; gallstone carriers: (GG) = 11 and (Gc) = 9.

Full size image

Discussion

The present study was performed to assess the role of cholesterol metabolism and intestinal transporters as related to the ABCG8 19H risk allele in gallstone disease. Four major observations were made: first, cholesterol absorption was decreased in gallstone carriers but cholesterol synthesis was not significantly different between individuals with gallstones and controls. Second, the ileal expression of the sterol transporters ABGG5, ABCG8 and NPC1L1 as well as of their relevant transcription factors is similar between gallstone carriers and controls. Third, in the cohort of gallstone carriers and controls the D19H polymorphism of the ABCG8 gene was associated with a low cholesterol absorption but not with altered de novo synthesis. Fourth, the ileal expression of the ABCG8 gene is not influenced by the presence of the mutated allele 19H.

Cholesterol and bile acid homeostasis are clearly altered in gallstone patients compared to a healthy population [3]. Most importantly, body weight influences cholesterol absorption and synthesis [42]. Obesity as well as excessive dietary fat and cholesterol uptake are common characteristics in industrial countries and are tightly related to gallstones [43–46]. Although the combination of multiple risk factors and mechanisms is known to contribute to the hypersaturation with cholesterol, the cause for biliary cholesterol hypersecretion is poorly defined. Cholesterol biosynthesis, biliary secretion, intestinal absorption and fecal loss are the major key steps of cholesterol homeostasis but only absorption and de novo synthesis determine the net body cholesterol supply. Basically, the absorption efficiency of cholesterol in the small intestine is defined by the concurrent influx and efflux of intraluminal cholesterol molecules crossing the apical membrane [47].

Studies in the murine model with deletion of the ABCG8 gene observed increased intestinal sterol absorption and reduced hepatic cholesterol secretion [48]. In contrast, overexpression of ABCG5/8 in mice promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol [20]. On the other hand, high cholesterol absorption efficiency and rapid biliary secretion of chylomicron remnant cholesterol enhance cholelithogenesis in gallstone-susceptible mice [49]. Enhanced hepatic expression of ABCG5/8 was already described in Chinese stone-carriers [50] and further studies provide evidence for the functional relevance of hepatic ABCG5/8 expression in relation to the biliary cholesterol secretion [20, 51, 52].

Measurements of the cholesterol precursor lathosterol allow indirect estimation of de novo cholesterol synthesis and the determination of plant sterols (sitosterol and campesterol) reflects intestinal cholesterol uptake [32, 33]. Using this technique our findings are clearly consistent with the observation that cholesterol synthesis is generally higher in overweight persons and the efficiency of cholesterol absorption is reduced [43, 46]. Moreover, in the current study a diminished cholesterol absorption ratio was noted in gallstone carriers compared to controls. This is in line with previous studies using either the isotope ratio method [3] or also serum surrogate markers [4]. However, there are controversial data regarding cholesterol de novo synthesis. The earlier studies found a decreased cholesterol synthesis in gallstone carriers (with high deoxycholate in bile) [11], whereas Kern found an increased synthesis [3]. In the recent study of Krawczyk reduced intestinal absorption concurred with a (possibly compensatory) enhanced hepatic cholesterol de novo synthesis [4]. However, in the present study the low intestinal cholesterol absorption was not coupled with enhanced hepatic de novo synthesis in gallstone carriers.

Looking for the possible mechanisms determining cholesterol absorption in the gut, the expression of ABCG8, ABCG5 and NPC1L1 as the key intestinal sterol transporters in humans was analysed. Regarding sterol exporter ABCG8 and ABCG5, no significant changes in expression were apparent, also not within the different weight groups. In line with the observation of Masson [53], the levels of ABCG5 correlated only moderately with those of ABCG8 in our study. Both proteins have different distribution profiles along the intestine and can exhibit variable transporter conformations with each other [54]. Recently, a Chinese study demonstrated an increased intestinal expression of NPC1L1 in gallstone patients as a mechanism for upregulated cholesterol absorption in the small intestine [55]. A decreased hepatic NPC1L1 down-regulation in normal weight female gallstone carriers was already described by Cui [56]. The highest expression levels of the transporter were determined in the jejunum [16] which is not easily accessible.

The polymorphism D19H of sterol exporter ABCG8 was associated with gallstones in various populations and different ethnic groups [29, 41, 57–61]. In line with prior observations the association with gallstones was confirmed in our population. However, overweight carriers of the ABCG8 19H risk allele displayed a higher OR than normal weight gallstone carriers. Obesity, of course, doubles the gallstone risk and strengthens the metabolic regulatory differences in cholesterol and bile acid homeostasis [3, 9, 44, 46]. In contrast to the study of Srivastava [59], the D19H relative risk was more pronounced in males than in females (Additional file 1: Table S2). This is probably due to a strong effect from the male overweight gallstone group.

Despite these descriptive studies about the relationship of D19H to the abnormalities in the lipid profile or to gallstones [29, 41, 62, 63], there are no direct cell culture studies on the functional influence of the polymorphism on transporter expression or activity so far. Most prior data, however, are compatible with a gain-of-function hypothesis of the 19H allele contributing to the cholesterol supersaturation of bile and the formation of cholesterol gallstones [27, 29]. In our study carriers of p.D19H were characterised by significantly reduced intestinal cholesterol absorption irrespective of the presence or absence of gallstones and the polymorphism did not affect intestinal ABCG8 expression. These results are compatible with the findings of Berge [30] in a normal non-gallstone cohort and those of Gylling showing that hypercholesterolemic carriers of the 19H allele exhibited reduced cholesterol absorption as well [31]. Since ABCG5/G8 are sterol exporters, a gain-of-function would lead to diminished absorption with excessive amounts of cholesterol secreted into intestine as well as bile [29, 31, 41]. It is unclear why in other cohorts [4] there was no association between the 19H risk allele and intestinal cholesterol absorption and also not with gallstones.

Conclusions

In summary, both the presence of gallstones and the ABCG8 polymorphism D19H were related to diminished cholesterol absorption but the polymorphism did not affect ileal expression of ABCG8, suggesting a gain-of-function of the mutated transporter. Since cholesterol absorption was also low in gallstone carriers without this polymorphism, this genetic trait does not fully explain this characteristic of gallstone disease.

References

  1. Schafmayer C, Hartleb J, Tepel J, Albers S, Freitag S, Voelzke H, Buch S, Seeger M, Timm B, Kremer B, Foelsch UR, Fändrich F, Krawczyk M, Schreiber S, Hampe J: Predictors of gallstone composition in 1.025 symptomatic gallstones from Northern Germany. BMC Gastroenterol. 2006, 6: 36-10.1186/1471-230X-6-36.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Wang DQ, Carey MC: Complete mapping of crystallization pathways during cholesterol precipitation from model bile: influence of physical-chemical variables of pathophysiologic relevance and identification of a stable liquid crystalline state in cold, dilute and hydrophilic bile salt-containing systems. J Lipid Res. 1996, 37 (3): 606-630.

    CAS  PubMed  Google Scholar 

  3. Kern F: Effects of dietary cholesterol on cholesterol and bile acid homeostasis in patients with cholesterol gallstones. J Clin Invest. 1994, 93: 1186-1189. 10.1172/JCI117072.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Krawczyk M, Lütjohann D, Schirin-Sokhan R, Villarroel L, Nervi F, Pimentel F, Lammert F, Miquel F: Phytosterol and cholesterol precursor levels indicate increased cholesterol excretion and biosynthesis in gallstone patients. Hepatology. 2012, 55 (5): 1507-1517. 10.1002/hep.25563.

    Article  CAS  PubMed  Google Scholar 

  5. Turley SD, Dietschy JM: The contribution of newly synthesized cholesterol to biliary cholesterol in the rat. J Biol Chem. 1981, 256 (5): 2438-2446.

    CAS  PubMed  Google Scholar 

  6. Scheibner J, Fuchs M, Schiemann M, Tauber G, Hörmann E, Stange EF: Bile acid synthesis from newly synthesized vs. preformed cholesterol precursor pools in the rat. Hepatology. 1993, 17 (6): 1095-1102. 10.1002/hep.1840170624.

    Article  CAS  PubMed  Google Scholar 

  7. Scheibner J, Fuchs M, Hörmann E, Tauber G, Stange EF: Biliary cholesterol secretion and bile acid formation in the hamster: the role of newly synthesized cholesterol. J Lipid Res. 1994, 35 (4): 690-697.

    CAS  PubMed  Google Scholar 

  8. Empen K, Lange K, Stange EF, Scheibner J: Newly synthesized cholesterol in human bile and plasma: quantitation by mass isotopomer distribution analysis. Am J Physiol. 1997, 272 (2 Pt 1): G367-G373.

    CAS  PubMed  Google Scholar 

  9. Klass DM, Bührmann K, Sauter G, Del Puppo M, Scheibner J, Fuchs M, Stange EF: Biliary lipids, cholesterol and bile synthesis: different adaptive mechanisms to dietary cholesterol in lean and obese subjects. Aliment Pharmacol Ther. 2006, 23 (7): 895-905. 10.1111/j.1365-2036.2006.02836.x.

    Article  CAS  PubMed  Google Scholar 

  10. Berr F, Pratschke E, Fischer S, Paumgartner G: Disorders of bile acid metabolism in cholesterol gallstone disease. J Clin Invest. 1992, 90 (3): 859-868. 10.1172/JCI115961.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Shoda J, He BF, Tanaka N, Matsuzaki Y, Osuga T, Yamamori S, Miyazaki H, Sjoevall J: Increase of deoxycholate in supersaturated bile of patients with cholesterol gallstone disease and its correlation with de novo syntheses of cholesterol and bile acids in liver, gallbladder emptying, and small intestinal transit. Hepatology. 1995, 21 (5): 1291-1302.

    CAS  PubMed  Google Scholar 

  12. Bergheim I, Harsch S, Mueller O, Schimmel S, Fritz P, Stange EF: Apical sodium bile acid transporter and ileal lipid binding protein in gallstone carriers. J Lipid Res. 2006, 47 (1): 42-50.

    Article  CAS  PubMed  Google Scholar 

  13. Renner O, Harsch S, Strohmeyer A, Schimmel S, Stange EF: Reduced ileal expression of OSTalpha OSTbeta in non-obese gallstone disease. J Lipid Res. 2008, 49 (9): 2045-2054. 10.1194/jlr.M800162-JLR200.

    Article  CAS  PubMed  Google Scholar 

  14. LaMont JT, Carey MC: Cholesterol gallstone formation. 2. Pathobiology and pathomechanics. Prog Liver Dis. 1992, 10: 165-191.

    CAS  PubMed  Google Scholar 

  15. Altmann SW, Davis HR, Zhu LJ, Yao X, Hoos LM, Tetzloff G, Iyer SP, Maguire M, Golovko A, Zeng M, Wang L, Murgolo N, Gtatiano MP: Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption. Science. 2004, 303 (5661): 1201-1204. 10.1126/science.1093131.

    Article  CAS  PubMed  Google Scholar 

  16. Sané AT, Sinnett D, Delvin E, Bendayan M, Marcil V, Ménard D, Beaulieu J-F, Levy E: Localization and role of NPC1L1 in cholesterol absorption in human intestine. J Lipid Res. 2006, 47 (10): 2112-2120. 10.1194/jlr.M600174-JLR200.

    Article  PubMed  Google Scholar 

  17. Davis HR, Zhu LJ, Hoos LM, Tetzloff G, Maguire M, Liu J, Yao X, Iyer SP, Lam M-H, Lund EG, Detmers PA, Graziano MP, Altmann SW: Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis. J Biol Chem. 2004, 279 (32): 33586-33592. 10.1074/jbc.M405817200.

    Article  CAS  PubMed  Google Scholar 

  18. Duval C, Touche V, Tailleux A, Fruchart JC, Fievet C, Clavey V, Staels B, Lestavel S: Niemann-Pick C1 like 1 gene expression is down-regulated by LXR activators in the intestine. Biochem Biophys Res Commun. 2006, 340 (4): 1259-1263. 10.1016/j.bbrc.2005.12.137.

    Article  CAS  PubMed  Google Scholar 

  19. Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H, Kojima H, Allikmets R, Sakuma N, Pegoraro R, Srivastava AK, Salen G, Dean M, Patel SB: Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption. Nat Genet. 2001, 27 (1): 79-83. 10.1038/83799.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC, Hobbs HH: Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest. 2002, 110 (5): 671-680.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Kosters A, Frijters RJ, Schaap FG, Vink E, Plösch T, Ottenhoff R, Jirsa M, De Cuyper IM, Kuipers F, Groen AK: Relation between hepatic expression of ATP-binding cassette transporters G5 and G8 and biliary cholesterol secretion in mice. J Hepatol. 2003, 38 (6): 710-716. 10.1016/S0168-8278(03)00093-X.

    Article  CAS  PubMed  Google Scholar 

  22. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ: Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem. 2002, 277 (21): 18793-18800. 10.1074/jbc.M109927200.

    Article  CAS  PubMed  Google Scholar 

  23. Pramfalk C, Jiang ZY, Cai Q, Hu H, Zhang SD, Han TQ, Eriksson M, Parini P: HNF1alpha and SREBP2 are important regulators of NPC1L1 in human liver. J Lipid Res. 2010, 51 (6): 1354-1362.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. van der Veen JN, Kruit JK, Havinga R, Baller JF, Chimini G, Lestavel S, Staels B, Groot PH, Groen AK, Kuipers F: Reduced cholesterol absorption upon PPARdelta activation coincides with decreased intestinal expression of NPC1L1. J Lipid Res. 2005, 46 (3): 526-534.

    Article  CAS  PubMed  Google Scholar 

  25. Iwayanagi Y, Takada T, Suzuki H: HNF4alpha is a crucial modulator of the cholesterol-dependent regulation of NPC1L1. Pharm Res. 2008, 25 (5): 1134-1141. 10.1007/s11095-007-9496-9.

    Article  CAS  PubMed  Google Scholar 

  26. Wittenburg H, Lyons MA, Paigen B, Carey MC: Mapping cholesterol gallstone susceptibility (Lith) genes in inbred mice. Dig Liver Dis. 2003, 35: S2-S7.

    Article  CAS  PubMed  Google Scholar 

  27. Wittenburg H, Lyons MA, Li R, Churchill GA, Carey MC, Paigen B: FXR and ABCG5/ABCG8 as determinants of cholesterol gallstone formation from quantitative trait locus mapping in mice. Gastroenterology. 2003, 125 (3): 868-881. 10.1016/S0016-5085(03)01053-9.

    Article  CAS  PubMed  Google Scholar 

  28. Katsika D, Grjibovski A, Einarsson C, Lammert F, Lichtenstein P, Marschall HU: Genetic and environmental influences on symptomatic gallstone disease: a Swedish study of 43,141 twin pairs. Hepatology. 2005, 41 (5): 1138-1143. 10.1002/hep.20654.

    Article  CAS  PubMed  Google Scholar 

  29. Buch S, Schafmayer C, Völzke H, Becker C, Franke A, von Eller-Eberstein H, Kluck C, Bässmann I, Brosch M, Lammert F, Miquel JF, Nervi F, Wittig M, Rosskopf D, Timm B, Höll C, Seeger M, ElSharawy A, Lu T, Egberts J, Faendrich F, Foelsch UR, Krawczak M, Schreiber S, Nürnberg P, Tepel J, Hampe J: A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease. Nat Genet. 2007, 39 (8): 995-999. 10.1038/ng2101.

    Article  CAS  PubMed  Google Scholar 

  30. Berge KE, von Bergmann K, Lutjohann D, Guerra R, Grundy SM, Hobbs HH, Cohen JC: Heritability of plasma noncholesterol sterols and relationship to DNA sequence polymorphism in ABCG5 and ABCG8. J Lipid Res. 2002, 43 (3): 486-494.

    CAS  PubMed  Google Scholar 

  31. Gylling H, Hallikainen M, Pihlajamäki J, Agren J, Laakso M, Rajaratnam RA, Rauramaa R, Miettinen TA: Polymorphisms in the ABCG5 and ABCG8 genes associate with cholesterol absorption and insulin sensitivity. J Lipid Res. 2004, 45 (9): 1660-1665. 10.1194/jlr.M300522-JLR200.

    Article  CAS  PubMed  Google Scholar 

  32. Sudhop T, Lütjohann D, Kodal A, Igel M, Tribble DL, Shah S, Perevozskaya I, von Bergmann K: Inhibition of intestinal cholesterol absorption by ezetimibe in humans. Circulation. 2002, 106 (15): 1943-1948. 10.1161/01.CIR.0000034044.95911.DC.

    Article  CAS  PubMed  Google Scholar 

  33. Miettinen TA, Tilvis RS, Kesaeniemi YA: Serum plant sterols and cholesterol precursors reflect cholesterol absorption and synthesis in volunteers of a randomly selected male population. Am J Epidemiol. 1990, 131 (1): 20-31.

    CAS  PubMed  Google Scholar 

  34. Renner O, Harsch S, Schaeffeler E, Schwab M, Klass DM, Kratzer W, Stange EF: Mutation screening of apical sodium-dependent bile acid transporter (SLC10A2): novel haplotype block including six newly identified variants linked to reduced expression. Hum Genet. 2009, 125 (4): 381-391. 10.1007/s00439-009-0630-0.

    Article  CAS  PubMed  Google Scholar 

  35. Wigginton JE, Cutler DJ, Abecasis GR: A note on exact tests of Hardy–Weinberg equilibrium. Am J Hum Genet. 2005, 76 (5): 887-893. 10.1086/429864.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Zamboni M, Mazzali G, Zoico E, Harris TB, Meigs JB, Di Francesco V, Fantin F, Bissoli L, Bosello O: Health consequences of obesity in the elderly: a review of four unresolved questions. Int J Obes (Lond). 2005, 29 (9): 1011-1029. 10.1038/sj.ijo.0803005.

    Article  CAS  Google Scholar 

  37. Donini LM, Savina C, Cannella C: Eating habits and appetite control in the elderly: the anorexia of aging. Int Psychogeriatr. 2003, 15 (1): 73-87. 10.1017/S1041610203008779.

    Article  PubMed  Google Scholar 

  38. Lechleitner M: Obesity and the metabolic syndrome in the elderly-a mini-review. Gerontology. 2008, 54 (5): 253-259. 10.1159/000161734.

    Article  CAS  PubMed  Google Scholar 

  39. Kuczmarski RJ, Flegal KM: Criteria for definition of overweight in transition: background and recommendations for the United States. Am J Clin Nutr. 2000, 72 (5): 1074-1081.

    CAS  PubMed  Google Scholar 

  40. Babiarczyk B, Turbiarz A: Body Mass Index elderly people - reference ranges matter. Prog Health Sci. 2012, 2 (1): 58-67.

    Google Scholar 

  41. Grünhage F, Acalovschi M, Tirziu S, Walier M, Wienker TF, Ciocan A, Mosteanu O, Sauerbruch T, Lammert F: Increased gallstone risk in humans conferred by common variant of hepatic ATP-binding cassette transporter for cholesterol. Hepatology. 2007, 46 (3): 793-801. 10.1002/hep.21847.

    Article  PubMed  Google Scholar 

  42. Simonen PP, Gylling H, Miettinen T: Body weight modulates cholesterol metabolism in non-insulin dependent type 2 diabetics. Obes Res. 2002, 10 (5): 328-335. 10.1038/oby.2002.46.

    Article  CAS  PubMed  Google Scholar 

  43. Gylling H, Hallikainen M, Kolehmainen M, Toppinen L, Pihlajamäki J, Mykkänen H, Agren JJ, Rauramaa R, Laakso M, Miettinen TA: Cholesterol synthesis prevails over absorption in metabolic syndrome. Transl Res. 2007, 149 (6): 310-316. 10.1016/j.trsl.2006.11.012.

    Article  CAS  PubMed  Google Scholar 

  44. Nakeeb A, Comuzzie AG, Martin L, Sonnenberg GE, Swartz-Basile D, Kissebah AH, Pitt HA: Gallstones: genetics versus environment. Ann Surg. 2002, 235 (6): 842-849. 10.1097/00000658-200206000-00012.

    Article  PubMed  PubMed Central  Google Scholar 

  45. Wilund KR, Feeney LA, Tomayko EJ, Weiss EP, Hagberg JM: Effects of endurance exercise training on markers of cholesterol absorption and synthesis. Physiol Res. 2009, 58 (4): 545-552.

    CAS  PubMed  Google Scholar 

  46. Miettinen TA, Gylling H: Cholesterol absorption efficiency and sterol metabolism in obesity. Atherosclerosis. 2000, 153 (1): 241-248. 10.1016/S0021-9150(00)00404-4.

    Article  CAS  PubMed  Google Scholar 

  47. Duan LP, Wang HH, Wang DQ: Cholesterol absorption is mainly regulated by the jejunal and ileal ATP-binding cassette sterol efflux transporters Abcg5 and Abcg8 in mice. J Lipid Res. 2004, 45 (7): 1312-13123. 10.1194/jlr.M400030-JLR200.

    Article  CAS  PubMed  Google Scholar 

  48. Wang HH, Patel SB, Carey MC, Wang DQ: Quantifying anomalous intestinal sterol uptake, lymphatic transport, and biliary secretion in Abcg8(−/−) mice. Hepatology. 2007, 45 (4): 998-1006. 10.1002/hep.21579.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Wang DQ, Zhang L, Wang HH: High cholesterol absorption efficiency and rapid biliary secretion of chylomicron remnant cholesterol enhance cholelithogenesis in gallstone-susceptible mice. Biochim Biophys Acta. 2005, 1733 (1): 90-99. 10.1016/j.bbalip.2004.12.005.

    Article  CAS  PubMed  Google Scholar 

  50. Jiang ZY, Parini P, Eggertsen G, Davis MA, Hu H, Suo GJ, Zhang SD, Rudel LL, Han TQ, Einarsson C: Increased expression of LXR alpha, ABCG5, ABCG8, and SR-BI in the liver from normolipidemic, nonobese Chinese gallstone patients. J Lipid Res. 2008, 49 (2): 464-472.

    Article  CAS  PubMed  Google Scholar 

  51. Kamisako T, Ogawa H: Regulation of biliary cholesterol secretion is associated with abcg5 and abcg8 expressions in the rats: effects of diosgenin and ethinyl estradiol. Hepatol Res. 2003, 26 (4): 348-352. 10.1016/S1386-6346(03)00153-0.

    Article  CAS  PubMed  Google Scholar 

  52. Yu L, von Bergmann K, Lütjohann D, Hobbs HH, Cohen JC: Selective sterol accumulation in ABCG5/ABCG8-deficient mice. J Lipid Res. 2004, 45 (2): 301-307.

    Article  CAS  PubMed  Google Scholar 

  53. Masson CJ, Plat J, Mensink RP, Namiot A, Kisielewski W, Namiot Z, Füllekrug J, Ehehalt R, Glatz JF, Pelsers MM: Fatty acid- and cholesterol transporter protein expression along the human intestinal tract. PLoS One. 2010, 5 (4): e10380-10.1371/journal.pone.0010380.

    Article  PubMed  PubMed Central  Google Scholar 

  54. Hirata T, Okabe M, Kobayashi A, Ueda K, Matsuo M: Molecular mechanisms of subcellular localization of ABCG5 and ABCG8. Biosci Biotechnol Biochem. 2009, 73 (3): 619-626. 10.1271/bbb.80694.

    Article  CAS  PubMed  Google Scholar 

  55. Jiang ZY, Jiang CY, Wang L, Wang JC, Zhang SD, Einarsson C, Eriksson M, Han TQ, Parini P, Eggertsen G: Increased NPC1L1 and ACAT2 expression in the jejunal mucosa from Chinese gallstone patients. Biochem Biophys Res Commun. 2009, 379 (1): 49-54. 10.1016/j.bbrc.2008.11.131.

    Article  CAS  PubMed  Google Scholar 

  56. Cui W, Jiang ZY, Cai Q, Zhang RY, Wu WZ, Wang JC, Fei J, Zhang SD, Han TQ: Decreased NPC1L1 expression in the liver from Chinese female gallstone patients. Lipids Health Dis. 2010, 9: 17-10.1186/1476-511X-9-17.

    Article  PubMed  PubMed Central  Google Scholar 

  57. Stender S, Frikke-Schmidt R, Nordestgaard BG, Tybjaerg-Hansen A: Sterol transporter adenosine triphosphate-binding cassette transporter G8, gallstones, and biliary cancer in 62,000 individuals from the general population. Hepatology. 2011, 53 (2): 640-648. 10.1002/hep.24046.

    Article  CAS  PubMed  Google Scholar 

  58. Xu HL, Cheng JR, Andreotti G, Gao YT, Rashid A, Wang BS, Shen MC, Chu LW, Yu K, Hsing AW: Cholesterol metabolism gene polymorphisms and the risk of biliary tract cancers and stones: a population-based case–control study in Shanghai, China. Carcinogenesis. 2011, 32 (1): 58-62. 10.1093/carcin/bgq194.

    Article  PubMed  Google Scholar 

  59. Srivastava A, Srivastava A, Srivastava K, Choudhuri G, Mittal B: Role of ABCG8 D19H (rs11887534) variant in gallstone susceptibility in northern India. J Gastroenterol Hepatol. 2010, 25 (11): 1758-1762. 10.1111/j.1440-1746.2010.06349.x.

    Article  CAS  PubMed  Google Scholar 

  60. Siddapuram SP, Mahurkar S, Duvvuru NR, Mitnala S, Guduru VR, Rebala P, Mansard MJ: Hepatic cholesterol transporter ABCG8 polymorphisms in gallstone disease in an Indian population. J Gastroenterol Hepatol. 2010, 25 (6): 1093-1098. 10.1111/j.1440-1746.2010.06309.x.

    Article  CAS  PubMed  Google Scholar 

  61. Kuo KK, Shin SJ, Chen ZC, Yang YH, Yang JF, Hsiao PJ: Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease. Br J Surg. 2008, 95 (8): 1005-1011. 10.1002/bjs.6178.

    Article  CAS  PubMed  Google Scholar 

  62. Acalovschi M, Ciocan A, Mostean O, Tirziu S, Chiorean E, Keppeler H, Schirin-Sokhan R, Lammert F: Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones. Eur J Intern Med. 2006, 17 (7): 490-494. 10.1016/j.ejim.2006.04.012.

    Article  CAS  PubMed  Google Scholar 

  63. Chen ZC, Shin SJ, Kuo KK, Lin KD, Yu ML, Hsiao PJ: Significant association of ABCG8:D19H gene polymorphism with hypercholesterolemia and insulin resistance. J Hum Genet. 2008, 53 (8): 757-763. 10.1007/s10038-008-0310-2.

    Article  CAS  PubMed  Google Scholar 

Pre-publication history

Download references

Acknowledgements

We are greatly indebted to Professor Dr. Klaus von Bergmann for valuable initiation of sterol measurements of this study. We thank the staff of the gastroenterological department and endoscopy team for recruitment of study participants and collecting tissue biopsies. The authors also thank Dr. Stephan Winter for competent statistical support and Anja Kerksiek for technical assistance.

Funding

This study was supported by the Robert Bosch Foundation (P4-1/03). The founders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author information

Authors and Affiliations

  1. Dr. Margarete Fischer-Bosch Institute of Clinical Pharmacology and University of Tuebingen, 70376, Stuttgart, Germany

    Olga Renner, Dominique Richter, André Strohmeyer, Silke Schimmel & Simone Harsch

  2. Institute for Clinical Chemistry and Clinical Pharmacology, Laboratory for Special Lipid Diagnostics, University of Bonn, Germany

    Dieter Lütjohann

  3. Department of Gastroenterology, Robert Bosch Hospital, 70376, Stuttgart, Germany

    Oliver Müller & Eduard F Stange

Authors
  1. Olga Renner
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Dieter Lütjohann
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Dominique Richter
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. André Strohmeyer
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Silke Schimmel
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Oliver Müller
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Eduard F Stange
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Simone Harsch
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Olga Renner or Eduard F Stange.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

Conceived and designed the experiments: OR SH. Performed the experiments: AS DR DL OR SS. Contributed reagents/materials/analysis tools: OM. Wrote the paper: OR SH. Supervised the study: SH EFS. All authors read and approved the final manuscript.

Electronic supplementary material

12876_2012_893_MOESM1_ESM.doc

Additional file 1: Table S1A: Anthropometric and metabolic characteristics of the Stuttgart study cohort, matched cohort (age, gender and BMI). Table S1B. Detailed comparison of intestinal cholesterol absorption surrogate markers according to weight. Table S1C. Anthropometric and metabolic characteristics of the female Stuttgart study cohort. Table S1D. Anthropometric and metabolic characteristics of the male Stuttgart study cohort. Table S2. The frequency of the variant D19H in the gallstone carriers and controls of the population from Stuttgart (with subgroups). (DOC 91 KB)

Authors’ original submitted files for images

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Renner, O., Lütjohann, D., Richter, D. et al. Role of the ABCG8 19H risk allele in cholesterol absorption and gallstone disease. BMC Gastroenterol 13, 30 (2013). https://doi.org/10.1186/1471-230X-13-30

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/1471-230X-13-30

Keywords

BMC Gastroenterology

ISSN: 1471-230X

Contact us