Table 3

Sequences of oligonucleotide primers used for stress-responsive gene expression analysis
Sequence description Sequence Number of bases AGI
DREB2-F TCGAGGAAAGGTTGTATGAGAGG 23 AT1G75490
DREB2-R AGAGTCGCTGCTGCTTTTTC 20 AT1G75490
COR15A-F ACTCAGTTCGTCGTCGTTTCTCAA 24 AT2G42540
COR15A-R GTTTGCGGCTTCTTTTCCTTTCT 23 AT2G42540
RD29A-F ATGAGAATGGTGCGACTAA 19 AT5G52310
RD29A-R CGTTGACCTTCCGTTGACCA 20 AT5G52310

Gachomo et al.

Gachomo et al. BMC Plant Biology 2013 13:79   doi:10.1186/1471-2229-13-79

Open Data