Table 2

Novel miRNAs identified from the six small RNA libraries
Name Count miRNA Sequence Fold energy
Mar-F-1-m0001 42 CGCUAUCCAUCCUGAGUUUCA −50.60
Mar-F-1-m0002 8 UCUUGUACUGCAUCAUAACUU −55.90
Mar-F-1-m0004 58 AGAGAUUGCAUUUCCUCUUCCA −29.40
Mar-F-1-m0006 12 UAACUGAAGAGUUUGAUCAUGG −90.50
Mar-F-1-m0011 24 UGCAAAUCCAGUCAAAAGUUA −33.90
Mar-F-1-m0013 21 GGGAAUUUCUGAUUGUCGGGG −46.30
Mar-F-1-m0017 34 UGCUCACUUCUCUUCUGUCAGC −57.60
Mar-F-1-m0018 78 UUCCAUCUCUUGCACACUGGA −44.60
Mar-F-1-m0019 13 CCAAGAGGAUUGAAGGCCAUG −39.30
Mar-F-1-m0022 11 GAAGCGCCUGGCAAGUUAGAC −42.80
Mar-F-1-m0024 72 CGAGCCGAAUCAAUAUCACUC −40.10
Mar-F-1-m0025 30 AGCUGCUUGGCUAUGGAUCCC −46.10
Mar-F-1-m0026 9 AUGACCAUUCAAGAAAGUGCU −59.25
Mar-F-1-m0027 82 GUAGUUGAACGACGUUUAUCUA −35.40
Mar-F-1-m0029 121 GGAGCAUCAUCAAGAUUCACA −48.11
Mar-F-1-m0030 1765 UUACUUUAGAUGUCUCCUUCA −48.92
Mar-F-1-m0031 52 UCCAAAGGGAUCGCAUUGAUC −58.70
Mar-F-1-m0032 14 ACGUUAUGGGCAUGGUAUGGA −50.92
Mar-F-1-m0033 12 CAUGACUUUUAGCGGCGUUUG −32.80
Mar-F-1-m0035 6 UGGUUUUCAAGUGGGAUUUGCUG −60.90
Mar-F-1-m0038 136 UUCAGAAACCAUCCCUUCCUU −58.60
Mar-F-1-m0039 3138 ACAGCUUUAGAAAUCAUCCCU −52.50
Mar-F-1-m0040 12 GCUCUCUAUGCUUCUGUCAUC −55.00
Mar-F-1-m0041 9 AUAUGUUAGAUCAAAGAGUAA −49.50
Mar-F-1-m0042 162 GGCUGUGGUUGAUUCGGCAAGA −37.55
Mar-F-1-m0043 73 AAUGGAGGAGUUGGAAAGAUU −37.39
Mar-F-1-m0044 14 AGUGGAUUGGGCUACAGUUUCUU −27.10
Mar-F-1-m0048 6 AUAAAAUACUGAUGUGACAUA −33.90
Mar-F-1-m0051 9 ACGGUUUUAAGUUUUAACUGA −28.42
Mar-F-1-m0052 9 GACGGUUUUAAGUUUUAACUG −28.42
Mar-F-1-m0053 12 UUGGCGAACAAAUCAGUAGGAGU −20.80
Mar-F-1-m0054 8 ACGACAGAAAAAAGGAUUGAUCA −30.30
Mar-F-1-m0055 21 AAGUGGGAUGGGUGGAAAGAUU −40.90
Mar-F-2-m0006 12 GGAGGAUCUCCAGGACUUGGCUU −36.69
Mar-F-2-m0014 219 GAUUUGGGGCAAAGACGGGAU −42.80
Mar-F-2-m0016 7 CUGGAUGCAGAGGUUUAUCGA −51.70
Mar-F-2-m0019 11 GUGAUUGGGCUAGGGUCUAGGCA −28.84
Mar-F-2-m0020 9 AAAACUGGACUGUUGUAUUGGUU −39.70
Mar-F-2-m0022 8 UUAGAUUCAUUGGCUGAGUUA −95.50
Mar-F-2-m0034 65 AACCAAUGACUAUUCAUGAUUCC −25.30
Mar-F-2-m0035 7 GGGAGAAAUUAGAUUGCCGA −18.33
Mar-F-2-m0039 10 AAGCUUGCUAGGCUCAAAGCCCA −20.00
Mar-F-2-m0043 11 GUUCGAUUCUCGGAAUGCCC −56.80
Mar-F-2-m0046 14 GGAAGGGAUAUAACUCAGCGGUA −28.60
Mar-F-2-m0051 12 AAAGGGAUGAUUUCUAAAGCU −47.85
Mar-F-2-m0055 10 UAUGUUAGAUCAAAGAGUAAAUU −48.90
Mar-F-2-m0058 18 UGCCUGGCUCCCUGUAUGCCU −42.10
Mar-F-2-m0064 8 AUACGACUAGCGCGACUCGA −83.97
Mar-F-2-m0065 10 AAGAGUCAGAUUGCAUUUUGC −25.40
Mar-F-2-m0067 11 AGGUACAGAGUCUGUUGGCAU −47.80
Mar-F-2-m0069 294 GAUGGGUGAGGGGGUAAGACA −52.80
Mar-F-2-m0071 8 AAGAGAGAAAGAGAGGCCUGGA −30.62
Mar-F-3-m0001 16 ACUAAAAAAUGGGCAAAUUAG −70.85
Mar-F-3-m0002 12 CUUUGGAGGGGAGAUUAGAGC −61.05
Mar-F-3-m0006 8 AGGGAAGGUUAGAUAUUUAUA −77.80
Mar-F-3-m0008 46 UAGAGAUUGCAUUUCCUCUUCC −29.40
Mar-F-3-m0014 10 CGUGGUGAUCAGUUGGACCUUU −23.40
Mar-F-3-m0018 6 GGCAGCGGUUCAUCGAUCUCU −28.70
Mar-F-3-m0029 5 UUUAAUUUCCUCCAAUAUCUUA −46.64
Mar-F-3-m0031 23 UGCCUGGCUCCCUGAAUGCCA −53.30
Mar-F-3-m0032 103 UAGCCAAGGAUGACUUGCCUG −54.30
Mar-F-3-m0035 18 UGAUAUUGGCCUGGUUCACUC −44.99
Mar-F-3-m0036 10 CUCUAUGGUAGAAUCAGUCGGGG −42.60
Mar-F-3-m0038 458 UUCCACAGCUUUCUUGAACUU −62.70
Mar-F-3-m0041 909 GGAAUGUUGUCUGGCUCGAGG −50.90
Mar-F-3-m0043 35 AGAUCAUGUGGCAGUUUCACC −45.64
Mar-F-3-m0044 7 AGAGCUUUCUUCAGUCCACUC −82.60
Mar-F-3-m0048 111 UUGGUGCGGUUCAAUCAGAUA −50.80
Mar-F-3-m0049 20 CGAAUGAUCUCGGACCAGGCU −35.76
Mar-F-3-m0050 154 AUCAUGUGGCAGUUUCACCUG −44.00
Mar-F-3-m0056 4369 UCUUGACCUUGUAAGACCUUU −48.30
Mar-F-3-m0058 10 GGAAUGUUGGCUGGCUCGAAG −52.60
Mar-F-3-m0064 38 UGAAUGAUUUCGGACCAGGCU −40.80
Mar-F-3-m0065 28 UGGUGCAGGUCGGGAACUGAU −76.37
Mar-F-3-m0067 65 UUCCACGGCUUUCUUGAACUU −51.20
Mar-F-3-m0070 22 UGCAUUCUGAUGUAUGGGGAC −69.07
Mar-F-3-m0080 14 UUUAAUAUUGUUUGGAUAUUGU −32.70
Mar-F-3-m0087 5 CGGCAAGUUGUCUUUGGCUAC −52.00
Mar-F-3-m0091 12 CAGGUGUAGCAUCAUCAAGAU −63.81
Mar-F-3-m0092 30 UCAGGUCAUCUUGCAGCUUCA −111.30
Mar-F-3-m0093 53 CGCUAUCUAUCCUGAGUUUCA −61.50
Mar-F-3-m0095 26 UUGAAGACCCAUUUGCAACCAA −24.80
Mar-F-3-m0110 15 CUCUUGUUGGGCAAAUGAGCAU −22.10
Mar-F-3-m0113 6 UGGGAACUUGAAGAUGAGGCU −29.40
Mar-F-3-m0115 15 AGGAGGAGCAGGAAGCAGUAACU −56.90
Mar-F-3-m0120 6 UUUCAACAUAGUAGAGGGACU −102.07
Mar-F-3-m0124 11 UAUAUGGCUUAAAACAGGCUCC −78.30
Mar-F-3-m0127 21 UCUUUCCUACUCCUCCCAUUCC −55.10
Mar-F-3-m0141 10 AUGGACAUCCAAGGGGGAGUGUU −50.46
Mar-F-3-m0146 15 UCCCUUUGGAUGUCUUCUUGC −75.70
Mar-F-3-m0164 22 UGGCUUCUAGACAGUGGAUGCA −23.40
Mar-F-3-m0178 24 UGUUGGCUCGGUUCACUCAGA −61.50
Mar-F-3-m0183 21 AUGCACUGCCUCUUCCCUGGC −50.60
Mar-F-3-m0185 160 UGGAGGCAGCGGUUCAUCGAUC −36.30
Mar-F-3-m0198 7 AAGAGUCAGAUUGCAUUUUG −25.40
Mar-F-3-m0200 9 AGAGGUGAUCAUGGGCCGGG −21.20
Mar-F-3-m0205 32 CAGCCCUGGUGUUGGACAUUC −46.00
Mar-S-1-m0013 9 GGGGCUGCAUUGAAGUGAAGGCU −76.70
Mar-S-1-m0014 7 UUCCACAGCUUUCUUGAACUG −49.30
Mar-S-1-m0035 12 ACAGGACAGGACAGGACAGGACA −68.99
Mar-S-1-m0039 13 UGGCGUAUGAGGAGCCAUGCA −51.90
Mar-S-1-m0097 18 AUAUGGCUUAAAACAGGCUCCA −78.30
Mar-S-1-m0110 8 AGAGGAGAAGAAAAUUCACUAUA −45.65
Mar-S-2-m0027 7 AUUGGUGAUUGACAUUUUUAUCU −33.10
Mar-S-2-m0040 67 GGAAUGGAGGAGUUGGAAAGA −47.59
Mar-S-2-m0043 6 UCUUUGAUCUAAUAUACAGG −40.30
Mar-S-2-m0046 7 AGUGUAAGACCUGUCUGGGACA −28.50
Mar-S-2-m0051 6 CUGAGGUUGGGUCGGACGACA −30.02
Mar-S-3-m0014 6 UCCAUGGUGGAGAUUGCUCUU −30.00
Mar-S-3-m0041 16 UGUUGAAGGUCGAUGGGUUAA −39.70

Wei et al.

Wei et al. BMC Plant Biology 2013 13:66   doi:10.1186/1471-2229-13-66

Open Data