Table 1

Candidate genes for SHR: sources of selection and features for genotyping the association mapping population
Source of selection Target locus Sunflower gene IDa Sequence lengthb SNPs in CSc Indels in CSd Haplotypes in CSe Genotyping methodf Primers for AMP genotyping
B. napus expression At1g34580
    HaMT
580 (191) 8 (8) 3 (11) 3 (2) FCE F:5′GAAAGGACATGCTACTTTATGG3′
R:5′CTTTACTTGAATTAAAGTTACT3′
profile At5g51550 HaPRP1 431 0 - 1
    HaPRP2
437 (166) 11 (11) - 3 (2) dHPLC F: 5′GGACGGGAACGTAAAATAATG3′
R: 5′CCGTCTGTCCGTACAATCG3′
At3g48310 HaCYP450A 786 1 (0) - 2
HaCYP450B 310 2 (0) - 2
    HaCYP450C
400 (260) 2 (2) 1 (1) 2 (6) dHPLC F: 5′AAGTGACTTTAGCAACGTCC3′
R: 5′GAGTTGGTATGGGTGGATGAA3′
At5g05940 HaROPGEF1 447 12 (11) 3 (50) 4
    HaROPGEF2
403 (197) 2 (2) 2 (11) 2 (2) FCE F: 5′TGCGTAGTGGTTCTAAAATTGG3′
R: 5′CGTCAATCATTACCCCAACC3′
HaROPGEF3 801 0 - 1
At1g48040
    HaPP2C
514 (398) 4 (4) - 2 (4) Direct sequencing F: 5′ACTGGGACTACGGCATTGAC3′
R: 5′TGCTGAATTTCTGGCTCTGA3′
At1g04450
    HaRIC_A
940 (261) 8 (8) 4 (6) 3 (2) FCE F: 5′GCACGAATAGTGACATTGAAAC3′
R:5′ACATAAAACAGTTTTCGGTCC3′
    HaRIC_B
1424 (537) 12 (0) 2 (15) 3 (3) FCE F: 5′GGCTTGCGTTACATCTCTGA3′
R: 5′CCCAACTAGGAGCATTGGAA 3′
At1g03687 HaHP1 198 0 1(1) 1
At4g09180
    HaHP2
309 (256) 1 (1) - 2 (5) Direct sequencing F: 5′CTGCTATCCAGGCTCATTCA3′
R: 5′AGAATGGCAGGGCGACCAAG3′
At1g13200 HaFbox1 265 11 (11) - 3
HaFbox2 262 8 (5) 1 (1) 5
At1g14687
    HaZFHD
166 (166) 9 (7) - 4 (9) Direct sequencing F:5′TCATGCCCTCACTAACATGC 3′
R: 5′TTTGTCCGGAATCTTTTTCG 3′
Sunflower EST library TC49193 HaDRP 587 14 (12) 1 (1) 2
BQ973243 HaCP 542 14 (10) - 3
-
    HaGDPDI
620 (707) 18 (14) 2 (2) 3 (10) Direct sequencing F: 5′CAGAAACTGATCAACCCGAAA 3′
R: 5′TGCATGCATCTTGGAAAATAG 3′
-
    HaCWP
351 (177) 4 (4) 3 (10) 2 (2) FCE F: 5′CAGGAATCACGGTCCCTAGT3′
R: 5′TGAAACATGAGGGATGAGCA3′
TC42391
    HaPI
658 (235) 14 (9) 3 (4) 5 (2) FCE F: 5′TCCAACAGTGTGTGACCTTTG3′
R: 5′CATTAGTTACGTTACAAAGCTAT3′
TC57179
    HaPAL
343 (343) 2 (2) - 2 (2) dHPLC F:5′TGTGGTCTTCAAATTCATTAATAAC3′
R: 5′GGCCATTCCTAACAGGATCA3′
Defense responses CF088675
    HaWRKY5
1395 (227) 39 (33) 14 (56) 8 (6) FCE F: 5′CCGATCAAAGGCTCAATCTA3′
R: 5′CACATCCGCTAGTTCACACC3′
BU016906
    HaWRKY7
1163 (174) 1 (1) 2 (22) 3 (2) FCE F: 5′CATTGTTGGTCAACCCTGTG3′
R: 5′AGGGAAGCATAACCATGACG3′
EU112647 HaGLP1 876 0 3 (3) 3
AJ540203 HaGLP2 794 6 (6) - 2
TC17527 HaGLP3 621 13 (9) - 6
TC18217
    HaGLP4
761 (209) 9 (2) 3 (11) 4 (4) FCE F: 5′TGGCTGCAACAACTTTCCTT3′
R: 5′TTCAATCCAGAAACAAACTTCTAA3′
TC17648 HaGLP5 1710 2 (1) 2 (3) 3

a Acronyms used throughout this article, candidate genes genotyped in the AMP are underlined.

b Length of PCR products sequenced in the CS. Length of PCR products genotyped in the AMP are given in parentheses.

c Parsimony informative sites are given in parentheses.

d Base pairs of indels are given in parentheses.

e Number of haplotypes detected in the AMP are given in parentheses.

f FCE: fluorescent capillary electrophoresis, dHPLC: denaturing high liquid performance chromatography.

g Primers 5’-end 6-FAM labeled.

Fusari et al.

Fusari et al. BMC Plant Biology 2012 12:93   doi:10.1186/1471-2229-12-93

Open Data