Table 1

A List of gene IDs and associated primers for the 15 analyzed promoters
Promoter name Primer information
No. Sequences
(pATDMC1) * pAT3G22880 OMC1657 GC
    GTCGAC
TGGTAGAGTCATGTTACTTAAGGT
OMC1656 GGACTAGT
    CCATGG
TCTCGCTCTAAGAGTCTCTAA
pAT3G19070* OCC555 ACGC
    GTCGAC
TCTTCAACATCAACCCGACC
OCC556 CATG
    CCATGG
CTTGCAACTTAAGAAATTTGATTC
pAT2G28090* OCC563 ACGC
    GTCGAC
TGGAAACTTAATGCAAACGC
OCC564 CATG
    CCATGG
TCGTCTCTAACTTCTTCTGC
(pMS5) * pAT4G20900 OCC553 ACGC
    GTCGAC
CTCGGCAAACGCCATAAC
OCC554 CATG
    CCATGG
TCTTTTTCGATTCTCTCTGTC
pAT1G26510* OCC557 ACGC
    GTCGAC
TTATTGCTCCCAACACTCG
OCC558 CATG
    CCATGG
TCAATCGCTCTTGTTTCG
pAT2G32310 OCC561 ACGC
    GTCGAC
TACTTGGGTGCTTTCTTGTG
OCC562 CATG
    CCATGG
TAACTTCTTTCCAAAGAATCTC
pAT3G49830* OCC565 ACGC
    GTCGAC
TAAGACTGATTTGCCAACAAGG
OCC566 CATG
    CCATGG
TCGGTTGTTGAGTTCACC
pAT4G40020* OCC567 ACGC
    GTCGAC
GGGGTTTAGGTCTTTCCAT
OCC568 CATG
    CCATGG
ATGATAGAATGTTTTTTATTCAGC
pAT2G21640* OCC569 ACGC
    GTCGAC
TGAAAGGTTTCCCACTCC
OCC570 CATG
    CCATGG
GAAAACAGAAAGAAATCTCATG
pAT3G07250* OCC571 AA
    CTGCAG
GCTTCGCAAATCCAACCT
OCC572 CATG
    CCATGG
ATAAAGATTCAACAAACATATAATGTC
pAT2G31141* OCC573 ACGC
    GTCGAC
CCATACAGAGTAAGCCAAACC
OCC574 CATG
    CCATGG
CCCTCCGACTTTAGAATCC
pAT1G15320* OCC575 ACGC
    GTCGAC
CAACTCACCACCTCCCTCT
OCC576 CATG
    CCATGG
TCGTGTTTCTTCTTCAGCACT
pAT1G64625* OCC577 ACGC
    GTCGAC
TTTCCTTGCTTGTGATCTTC
OCC552 CATG
    CCATGG
TTAGGAATCCAAGCCGGG
pAT3G52770 OCC648 ACGC
    GTCGAC
TACAAAATGGTCCAAAACGG
OCC649 CATG
    CCATGG
CTGCTTTCTTGCTACAAGTAAAAC
pAT1G24220 OCC625 ACGC
    GTCGAC
GAAGACATGAGATTTTGGGGTCA
OCC560 CATG
    CCATGG
CTAAACCCTCCAAG

* refers to meiotically-active promoter. For each primer pair, the former one is the sense primer, the later one is the antisense primer; The PstI (CTGCAG) or SalI (GTCGAC) sites in sense primers, the NcoI (CCATGG) sites in antisense primers are underlined.

Li et al.

Li et al. BMC Plant Biology 2012 12:104   doi:10.1186/1471-2229-12-104

Open Data