Table 5

Summary of chickpea CBL- CIPK- and AGP-annotated UniTags in chickpea roots and nodules

UniTag ID

Sequence

Uniprot ID

Gene class

R(ln) Roots

R(ln) Nodules


CBL proteins

STCa-10400

CATGCTTGTTATAGTTAGCCTTTCTC

Q5EE13_9FABA

CBL

-0,21

-0,16

STCa-8869

CATGCCTTACTTTGGGTGTGACGATT

Q7FZ95_EUCGR

CBL

0,89

-0,16

STCa-12426

CATGGATGTGGAAAATGAAATCCTTG

CNBLA_ARATH

CBL 10

-0,90

0,53

STCa-7792

CATGCATATGTACTGAACCCAGTTAA

A4ZKI5_POPTR

CBL 4-1

-2,00

-0,16


CIPK proteins

STCa-4035

CATGAGTTTGAGATTTGTACTGTTGT

Q8LK24_SOYBN

CIPK

0,20

-0,16

STCa-1179

CATGAAGAATCCTTGTTGATGATTCA

Q8LK24_SOYBN

CIPK

1,99

-0,38

STCa-21948

CATGTGTTACTTGGGAGTGTCTGGTT

A0MNJ9_POPTR

CIPK 12

1,58

1,63

STCa-19413

CATGTCAAACTACAGCAGCTGAAGCT

A0MNK6_POPTR

CIPK 19

-1,60

-0,85

STCa-19111

CATGTATGTATGGATATATATATACT

A0MNK8_POPTR

CIPK 22

0,89

0,53

STCa-5485

CATGATGTTATTATTTTTGATTTGAT

A0MNL1_POPTR

CIPK 25

-0,21

0,53

STCa-21387

CATGTGGTGTTATTCTCTTTGTTCTT

A0MNL1_POPTR

CIPK 25

0,48

-1,55

STCa-12635

CATGGCAAGGAGAACAACCACAGCAA

A0MNL4_POPTR

CIPK 6

-2,80

-0,72

STCa-132

CATGAAAAGAATAGTGGGTAGTGTTT

CIPK7_ARATH

CIPK 7

-0,21

-0,85

STCa-6698

CATGCAATGTAATATAAGACCCTAAT

CIPK9_ARATH

CIPK 9

-1,19

1,92


AGP proteins

STCa-17547

CATGTAATGTAATATTGTTGAATGAA

Q8L5F8_CICAR

AGP

--

0,53

STCa-18898

CATGTATCATTTATTTTCTTTTTTTG

Q9XIV1_CUCSA

AGP

1,40

0,53

STCa-17548

CATGTAATGTAATATTGTTGTGAAAA

Q8L5F8_CICAR

AGP

0,89

--

STCa-17550

CATGTAATGTAATATTGTTGTGATTT

Q8L5F8_CICAR

AGP

-0,12

0,28

STCa-23251

CATGTTGATGTTGGAGAGAGGGCTTT

AGP20_ARATH

AGP

0,53

0,22

STCa-17544

CATGTAATGTAATATCGTTGTGATTT

Q8L5F8_CICAR

AGP

0,48

--

STCa-17549

CATGTAATGTAATATTGTTGTGATTA

Q8L5F8_CICAR

AGP

0,48

--

STCa-19513

CATGTCACAACTCATAAAAAAGTACA

Q8L5F8_CICAR

AGP

--

-0,16

STCa-21051

CATGTGGAGTAGTTTGATTTGTGCAG

Q8L5F8_CICAR

AGP

-0,21

--

STCa-635

CATGAAATGTAATATTGTTGTGATTT

Q8L5F8_CICAR

AGP

--

-0,85

STCa-23101

CATGTTGAAGTGAAATATGAAATGAA

A7J385_GOSHI

AGP

0,48

-0,85

STCa-8606

CATGCCCTCACCTCTCCTTTCATCAT

AGP25_ARATH

AGP

-1,60

-1,55


Molina et al. BMC Plant Biology 2011 11:31   doi:10.1186/1471-2229-11-31

Open Data