Email updates

Keep up to date with the latest news and content from BMC Plant Biology and BioMed Central.

Open Access Highly Accessed Research article

Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait

Anh-Tung Pham, Jeong-Dong Lee, J Grover Shannon and Kristin D Bilyeu*

BMC Plant Biology 2010, 10:195  doi:10.1186/1471-2229-10-195

PubMed Commons is an experimental system of commenting on PubMed abstracts, introduced in October 2013. Comments are displayed on the abstract page, but during the initial closed pilot, only registered users can read or post comments. Any researcher who is listed as an author of an article indexed by PubMed is entitled to participate in the pilot. If you would like to participate and need an invitation, please email info@biomedcentral.com, giving the PubMed ID of an article on which you are an author. For more information, see the PubMed Commons FAQ.

CORRECTION

K Bilyeu   (2011-09-07 16:57)  USDA/ARS Plant Genetics Research Unit email

BMC Plant Biology 2010, 10:195doi:10.1186/1471-2229-10-195
Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait

CORRECTION:
In the Methods, under the subsection FAD2-1B allele specific molecular marker assay, incorrect primer sequences were inadvertently listed:
Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'-ACTGCATCGAATAATACAAGCC-3' at 2 μM final concentration, and 5'-TGATATTGTCCCGTCCAGC-3' at 5 μM final concentration).

The correct sentence should read:
Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'- GGTTCTCCAAGGTTGCATTCTTACT -3' at 2 μM final concentration, and 5'- AGGGTTGTTCAGGTACTTGGTGT -3' at 5 μM final concentration).

Kristin Bilyeu
31 August 2011

Competing interests

No competing interests.

top

Post a comment