Table 1

Comparison of average microarray and qPCR results for 6 selected genes. 3 genes downregulated in Hdh-KO cells are shown in blue, 3 genes upregulated in Hdh-KO cells are shown in red. The average signals obatined in Microarray and qPCR experiments are shown for each gene. Also shown are primers used for qPCR experiments and the fold change calculated from microarry and qPCR data by dividing average Hdh-KO signal to average Hdh-HET signal.

Gene

GeneBank Acc #

Microrray

Q-PCR



HET

KO

Fold

Primers (FP/RP)

HET

KO

Fold


Hdh

NM_010414

303.7

-0.9

DOWN

CGTGAGCATCTGCCAACATT

CACACCGAGGATCAGGAGAGT

404.3

2.0

-202.2

Sox-2

NM_011443

233.7

-5.6

DOWN

GATGCACAACTCGGAGATCAG

GCTTCTCGGTCTCGGACAA

16615.9

18.4

-903.0

Tcf2

NM_009330

255.6

7.3

-35.0

CACCTGACAGTAAAATGCAGATCA

GAGTGTGTGCTGTGGATATTCGT

4513.7

2.6

-1736.0

Cart1

NM_172553

-9.3

286.9

UP

CCCTGAGAACGGAGCTCACT

TTGGCCCTTCGATTTTGAA

12.5

45701.8

3656.1

Esm1

NM_023612

-35.6

498.6

UP

GCGAGGAGGATGATTTTGGT

GCATTCCATCCCGAAGGT

19.7

2966.9

150.6

Pitx2

NM_011098

124.8

1811.8

14.5

CCGAGTCCGGGTTTGG

TTGCGTTCCCGCTTTCTC

21.3

368.2

17.3


Zhang et al. BMC Neuroscience 2008 9:38   doi:10.1186/1471-2202-9-38

Open Data